C___8952966_10

SNP ID:

rs1015322

Gene

NPAS3 SNORA89

Gene Name

neuronal PAS domain protein 3

small nucleolar RNA, H/ACA box 89

Set Membership:

> HapMap > Validated

Chromosome Location:

Chr.14: 33709098 - 33709098 on Build GRCh38

Polymorphism:

A/G, Transition substitution

Context Sequence [VIC/FAM]:

TATTTATTGATTGAATGAGTGGACA[A/G]TTCTCCACAACACCCAAGTGGCTTT

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 609430
Literature Links:	NPAS3 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global A (0.43) (0.57)	Caucasian A (0.25) (0.75)	CEPH (CEU) A (0.30) (0.70)
EAS A (0.43) (0.57)	African American A (0.41) (0.59)	YRI (Yoruba) A (0.43) (0.57)
SAS A (0.45) (0.55)	Japanese A (0.48) (0.52)	JPT (Japanese) G (0.49) (0.51)
AFR A (0.42) (0.58)	Chinese A (0.37) (0.63)	CHB (Han Chinese) A (0.36) (0.64)
EUR A (0.33) (0.67)
AMR G (0.43) (0.57)

NPAS3 - neuronal PAS domain protein 3
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001164749.1		Intron			NP_001158221.1
NM_001165893.1		Intron			NP_001159365.1
NM_022123.2		Intron			NP_071406.1
NM_173159.2		Intron			NP_775182.1
XM_005267991.3		Intron			XP_005268048.2
XM_005267992.3		Intron			XP_005268049.2
XM_011537067.2		Intron			XP_011535369.1
XM_011537069.2		Intron			XP_011535371.2
XM_011537070.2		Intron			XP_011535372.1
XM_011537071.2		Intron			XP_011535373.2
XM_011537072.2		Intron			XP_011535374.1
XM_017021582.1		Intron			XP_016877071.1
XM_017021583.1		Intron			XP_016877072.1
XM_017021584.1		Intron			XP_016877073.1
XM_017021585.1		Intron			XP_016877074.1
XM_017021586.1		Intron			XP_016877075.1
XM_017021587.1		Intron			XP_016877076.1
XM_017021588.1		Intron			XP_016877077.1

SNORA89 - small nucleolar RNA, H/ACA box 89
There are no transcripts associated with this gene.

More Information

• Set Membership: HapMap, Validated

Panther Classification:

Molecular Function -

basic helix-loop-helix transcription factor

Gene Ontology Categories:

Process(es)

transcription, DNA-templated
regulation of transcription from RNA polymerase II promoter
developmental process
positive regulation of transcription, DNA-templated

Function(s)

RNA polymerase II transcription factor activity, sequence-specific DNA binding
DNA binding
protein dimerization activity