C___9736141_10

SNP ID:

rs940523

Gene

PEX5L PEX5L-AS2

Gene Name

peroxisomal biogenesis factor 5 like

PEX5L antisense RNA 2

Set Membership:

> HapMap > Validated

Chromosome Location:

Chr.3: 179904166 - 179904166 on Build GRCh38

Polymorphism:

A/T, Transversion substitution

Context Sequence [VIC/FAM]:

CAGGGTATTGAAAAGAAAGATTTCC[A/T]GTTGACCCTTTATGTATTTCTCCCT

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 611058
Literature Links:	PEX5L PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global T (0.18) (0.82)	Caucasian T (0.40) (0.60)	CEPH (CEU) - Not Available
EAS T (0.12) (0.88)	African American T (0.14) (0.86)	YRI (Yoruba) T (0.05) (0.95)
SAS T (0.28) (0.72)	Chinese - Not Available	JPT (Japanese) T (0.11) (0.89)
AFR T (0.05) (0.95)	Japanese - Not Available	CHB (Han Chinese) T (0.07) (0.93)
EUR T (0.32) (0.68)
AMR T (0.20) (0.80)

PEX5L - peroxisomal biogenesis factor 5 like
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001256750.1		Intron			NP_001243679.1
NM_001256751.1		Intron			NP_001243680.1
NM_001256752.1		Intron			NP_001243681.1
NM_001256753.1		Intron			NP_001243682.1
NM_001256754.1		Intron			NP_001243683.1
NM_001256755.1		Intron			NP_001243684.1
NM_001256756.1		Intron			NP_001243685.1
NM_016559.2		Intron			NP_057643.1
XM_011512882.2		Intron			XP_011511184.1
XM_011512884.2		Intron			XP_011511186.1
XM_011512885.2		Intron			XP_011511187.1
XM_011512886.2		Intron			XP_011511188.1
XM_011512887.2		Intron			XP_011511189.1
XM_011512888.2		Intron			XP_011511190.1
XM_011512891.2		Intron			XP_011511193.1
XM_011512892.2		Intron			XP_011511194.1
XM_017006601.1		Intron			XP_016862090.1
XM_017006602.1		Intron			XP_016862091.1
XM_017006603.1		Intron			XP_016862092.1
XM_017006604.1		Intron			XP_016862093.1
XM_017006605.1		Intron			XP_016862094.1
XM_017006606.1		Intron			XP_016862095.1
XM_017006607.1		Intron			XP_016862096.1
XM_017006608.1		Intron			XP_016862097.1
XM_017006609.1		Intron			XP_016862098.1
XM_017006610.1		Intron			XP_016862099.1
XM_017006611.1		Intron			XP_016862100.1

PEX5L-AS2 - PEX5L antisense RNA 2
There are no transcripts associated with this gene.

More Information

• Set Membership: HapMap, Validated

Panther Classification:

Molecular Function -

membrane trafficking regulatory protein

Gene Ontology Categories:

Process(es)

protein import into peroxisome matrix, docking
regulation of cAMP-mediated signaling

Function(s)

peroxisome targeting sequence binding
small GTPase binding