C____317982_10

• SNP ID: rs939268
• Gene: TRIM35
• Gene Name: tripartite motif containing 35
• Set Membership: > Validated
• Chromosome Location: Chr.8: 27297169 - 27297169 on Build GRCh38
• Polymorphism: A/G, Transition substitution
• Context Sequence [VIC/FAM]:

  TGGCTCAGGGTAAACTCCACAGCCA[A/G]ATGTTAATGAGGCTCTTTCCTGGGA

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 617007
Literature Links:	TRIM35 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global A (0.04) (0.96)	Caucasian A (0.14) (0.86)	CEPH (CEU) - Not Available
EAS A (0.00) (1.00)	African American A (0.02) (0.98)	YRI (Yoruba) - Not Available
SAS A (0.02) (0.98)	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR A (0.00) (1.00)	Japanese - Not Available	JPT (Japanese) - Not Available
EUR A (0.12) (0.88)
AMR A (0.07) (0.93)

TRIM35 - tripartite motif containing 35
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001304495.1		Intron			NP_001291424.1
NM_171982.4		Intron			NP_741983.2
XM_005273452.3		Intron			XP_005273509.1
XM_011544453.1		Intron			XP_011542755.1

More Information

• Set Membership: Validated

Panther Classification:

Molecular Function -

ubiquitin-protein ligase

Gene Ontology Categories:

Process(es)

apoptotic process
positive regulation of apoptotic process
innate immune response
negative regulation of mitotic cell cycle
negative regulation of viral release from host cell

Function(s)

molecular_function
zinc ion binding