More Information
Updated Mapping Information
Related Products
miRBase Alias:
Rat: rno-miR-489 (v15)
Please enter the information below and press OK to send your cart to Core Services for purchase.

| Assay Name: | rno-miR-489 |
|---|---|
| miRBase Version: | v22.1 |
| Mature miRNA Sequence: | AAUGACAUCACAUAUAUGGCAGC |
| Product Type: | TaqMan™ MicroRNA Assay |