Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

Genscript Corporation PRIMER TACACACAGCCGGCACTCAG

Supplier:  Genscript Corporation LINE 9QTU543F153G0

Encompass
This product was recently added by customer request, and is available for your convenience. We strive to provide our customers with a one-stop shop for the entire scientific supplies category. More relevant content may be added as customer demand increases.

Catalog No. NC2905408


Product Content Correction

The Fisher Scientific Encompass Program offers items which are not part of our distribution portfolio. These products typically do not have pictures or detailed descriptions. However, we are committed to improving your shopping experience. Please use the form below to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Your feedback has been submitted: Thank you for helping us improve our website.