Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More
Learn More
Genscript Corporation PRIMER TACACACAGCCGGCACTCAG
Supplier: Genscript Corporation LINE 9QTU543F153G0

This product was recently added by customer request, and is available for your convenience. We strive to provide our customers with a one-stop shop for the entire scientific supplies category. More relevant content may be added as customer demand increases.
Product Content Correction
The Fisher Scientific Encompass Program offers items which are not part of our distribution portfolio. These products typically do not have pictures or detailed descriptions. However, we are committed to improving your shopping experience. Please use the form below to provide feedback related to the content on this product.
Product Title
Spot an opportunity for improvement?Share a Content Correction