Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More
  1. Home
  2. Products
  3. 502237903

New England Biolabs, Inc. Control LAMP Primer Mix (rActin) - 50 rxns
SDP

Supplier:  New England Biolabs, Inc. S0164S

Encompass

The Control LAMP Primer Mix (rActin) targets actin RNA at an exon-exon junction. It is a LAMP primer set (F3 B3 FIP BIP LF LB) that amplifies rActin to ensure the absence of inhibition from human nucleic acid templates in a LAMP reaction. Control LAMP Primer Sequences rActin (5 3) rActin Primer Set Sequence ACTB-F3 AGTACCCCATCGAGCACG ACTB-B3 AGCCTGGATAGCAACGTACA ACTB-FIP GAGCCACACGCAGCTCATTGTATCACCAACTGGGACGACA ACTB-BIP CTGAACCCCAAGGCCAACCGGCTGGGGTGTTGAAGGTC ACTB-LF TGTGGTGCCAGATTTTCTCCA ACTB-LB CGAGAAGATGACCCAGATCATGT

Catalog No. 50-223-7903


May include imposed supplier surcharges.
Only null left
Add to Cart
This item is not returnable. View return policy

Product Content Correction

The Fisher Scientific Encompass Program offers items which are not part of our distribution portfolio. These products typically do not have pictures or detailed descriptions. However, we are committed to improving your shopping experience. Please use the form below to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Your feedback has been submitted: Thank you for helping us improve our website.