Applied Biosystems™ Custom TaqMan™ SNP Genotyping Assay, non-human

Catalog No.	Quantity
43-320-77	S (300 reactions), made to order
43-320-76	L (2400 reactions), made to order

Catalog No. 43-320-77 Supplier Applied Biosystems™ Supplier No. 4332077

Description

Includes

Two unlabelled PCR primers: forward and reverse (primers at 900nM final concentration); 1 VIC dye: MGB-labeled probe detects the Allele 1 sequence (probes at 200nM final concentration); 1 6FAM dye: MGB labeled probe detects the Allele 2 sequence (probes at 200nM final concentration)

Applied Biosystems TaqMan SNP Genotyping Assays use TaqMan 5'‐nuclease chemistry to amplify and detect specific polymorphisms in purified genomic DNA samples.

Applied Biosystems TaqMan SNP Genotyping Assays use TaqMan 5'‐nuclease chemistry to amplify and detect specific polymorphisms in purified genomic DNA samples. Each assay enables genotyping of individuals for a single nucleotide polymorphism (SNP) and consists of two sequence-specific primers and two TaqMan minor groove binder (MGB) probes with non-fluorescent quenchers (NFQ). One probe is labeled with VIC dye to detect the Allele 1 sequence; the second probe is labeled with FAM dye to detect the Allele 2 sequence.

Custom TaqMan SNP Genotyping Assays can be easily designed at no extra charge by submitting target sequences confidentially to our secure Custom Assay Design Tool. The tool can generate assay designs targeting any SNP in any organism, offering maximum flexibility to meet your research needs.

Benefits:

• Proven—gold-standard TaqMan chemistry and robust assay designs deliver accurate, reproducible, and reliable results
• Easy—convenient single-tube format and simple workflow provide an easy path to trusted results; no optimization required
• Flexible—obtain assay designs for any SNP in any organism using our secure Custom Assay Design Tool, at no extra charge
• Tested—all custom assays are quality-control tested for synthesis accuracy and formulation completeness

Approximate ship time

4–6 days in North America and 6–10 days in Europe

The free Custom Assay Design Tool can generate assays for the detection of SNPs, MNPs, and indels of up to six bases. These custom assays are designed, synthesized, formulated, optimized, and quality control tested.

TaqMan SNP Genotyping Assays require only three reaction components for PCR: purified genomic DNA (1–20 ng), the assay solution, and TaqMan Genotyping Master Mix (or another compatible master mix) (sold separately).

All assay designs are the product of our industry-leading bioinformatics pipeline, optimized over the course of more than a decade by leveraging manufacturing and assay performance data. TaqMan Assays have been cited in over 40,000 publications and are backed by more than 350 patents.

Recommended master mix (sold separately): TaqMan Genotyping Master Mix (Cat. No. 4371355)

Specifications

• Quantity: S (300 reactions), made to order
• For Use With (Equipment): 7500 System, 7500 Fast System, 7900HT System, StepOne™, StepOnePlus™, ViiA™ 7 System, QuantStudio™ Absolute Q Digital PCR System, QuantStudio™ 3, QuantStudio™ 5, QuantStudio™ 6 Flex, QuantStudio™ 7 Flex, QuantStudio 6 Pro, QuantStudio 7 Pro, QuantStudio™ 12k Flex ProFlex PCR System*, VeritiPro*, SimpliAmp*, MiniAmp*, Automated Thermal Cycler** If a thermal cycler is used for PCR amplification, the optional pre-read and the post-read must be performed separately on a real-time PCR system in order to detect and record fluorescent signals.
• Shipping Condition: Room Temperature
• Product Line: TaqMan
• Product Type: Custom TaqMan Genotyping
• Sample Type: Non-human
• Content And Storage: 1 tube containing a 40X (S and M sizes) or 80X (L size) mix of pre-formulated assay (2 probes and 2 primers).
  
  Store at -15 to -25°C.
  
  
• Concentration: 40X
• No. of Reactions: 1500 (384-well); 300 (96-well)

Frequently Asked Questions (FAQs)

How do I set up a reference panel in the TaqMan Genotyper Software?

A reference panel is helpful in large studies to mark your reference samples. Please follow the directions here on how to set up a reference panel.

How do I enter the polymorphism sequence information (i.e., A, C, G, T) for my assays, and where is this info displayed in the TaqMan Genotyper Software?

The polymorphism sequence info can be entered into the software through Setup >Assays. You can import an assay information file (AIF) that contains this info for your assays (AIFs are shipped with assay orders), or manually enter this info for each assay using the edit assay feature. The polymorphism sequence info will be displayed in the assays table under allele1 base and allele2 base, in the results table in the calls column, in the cluster plot display in the x-axis and y-axis titles, and in the export files as genotypes. If no sequence information is entered for an assay, the default display for genotype calls will use the dye names, such as VIC/VIC, VIC/FAM or FAM/FAM dyes.

What is the bookmarking feature in the TaqMan Genotyper Software, and how would I use it?

Bookmarking is a unique feature in TaqMan Genotyper Software that allows you to tag a data point or well while reviewing results in a Study. For example, in reviewing a cluster plot for an assay, a data point is observed to be somewhat between clusters. You can set a bookmark for this data point to denote this well for further investigation. The bookmark persists between the Results workspace and Quality Control workspace, so you can easily identify the data point in a cluster plot, experiment plate view, or on the samples tab. Bookmarks are cleared upon exit from a Study or exit from the application.

I am getting the message: "An error has occurred. See the log file C:\ProgramFiles\Applied Biosystems\TaqMan Genotyper\config\eclipse\1363113099385.log." How can I fix this?

1.Go to the Start button, then Programs, then TaqMan Genotyper Software
2.Right-click on the program and choose “Run as Administrator”
3.If that does not work, go back to the same menu and choose “Properties”
4.Choose the “Compatibility” tab, and check “Run this program as administrator”
5.Click “Apply”
6.You may+C69 have to restart the computer for the settings to apply

Can I delete an assay or sample from my qPCR study?

An assay or sample may be deleted from a study only if there is no data or wells associated with it. Upon import of an experiment, the software collects all the assays and samples from the plate and lists them in the Setup > Assays or Setup > Samples workspaces. The assays and samples are stored in these workspaces as a library, and remain there even if you delete the experiment from the Study. Deleting the experiment will remove any data (wells) associated with the assays or samples, but not the assays or samples from the library. The assays and samples must then be deleted from these workspaces to remove them from the Study.

I have imported experiment files into my study. Can I now edit the assay IDs and/or sample IDs in the TaqMan Genotyper Software?

The software does not allow assay IDs or sample IDs to be modified. If a typing error occurred or an edit is required, this change must be made in the original experiment file. The software does, however, allow you to create your own assay name and add additional information related to an assay or sample through Setup --> Assays or Setup --> Samples.

I have trailing clusters in my allelic discrimination plot. What can I do to improve the clustering?

Trailing clusters are often due to variation in gDNA quality or concentration. Please see the example here for more details (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/qpcr-education/real-time-pcr-troubleshooting-tool/snp-genotyping-troubleshooting/trailing-clusters.html).

I'm getting more than 3 clusters with my qPCR assay. What is wrong?

Multiple clusters such as in the example below could be due to a hidden SNP under the probe or primer. Search dbSNP (https://www.ncbi.nlm.nih.gov/SNP/) for other SNPs around the target SNP. If the nontarget SNP has a low MAF it will usually not be a problem. If the nontarget SNP is under a primer, try to redesign and mask it as an “N”. Another possibility is that the region is within a copy number variation, in which case you will have to evaluate with a TaqMan Copy Number Assay as well.

I'm only getting a single cluster after qPCR. Why is that?

Check the Minor Allele Frequency (MAF) of the SNP. You may need a larger sample size in order to see the allele. You can use the Hardy-Weinberg equation to determine if the minor allele is detectable in your sample size or not. Follow the example here (p. 4-2).

My clusters are too close together when performing qPCR. What can I do?

Depending on the assay, you may want to try either reducing or increasing the number of cycles. Our newer instrument software can even allow you to view the traces if you collect the real-time data on the instrument.

Why is the autocalling in the software not working? What can I do?

If you are not getting calls in the instrument software, you can try the free TaqMan Genotyper Software. This program has an improved algorithm which allows it to make calls that are often missed by the SDS software.

My SNP assay is not amplifying. What is wrong?

There are several reasons for a SNP assay not amplifying, including:

-DNA may not be accurately quantitated
-Degraded DNA
-Inhibitors in the sample
-Error in reaction setup

Check out our troubleshooting tool for more details at https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/qpcr-education/real-time-pcr-troubleshooting-tool/snp-genotyping-troubleshooting/snp-not-amplifying.html.

My custom SNP assay failed and my order was canceled. Why did it fail, and what can I do?

This could happen if the assay fails functional testing. All human SNP genotyping assays get tested with a panel of human gDNA samples. The assay must show amplification with at least one cluster in order to pass. When there is no amplification you will be notified of the failure and not charged for the assay. The assay may have failed for the following reasons:

-Input sequence was incorrect (cDNA instead of gDNA)
-Input sequence was not human
-Input sequence was not appropriately pre-screened
-Signal from NTC was less than 0.5 units from samples (assay did not give high fluorescence signal)

To resolve this, please consult the guidelines in the Design and Ordering Guide (https://tools.thermofisher.com/content/sfs/manuals/cms_042307.pdf) to properly prepare the sequence for the Custom Assay Design Tool (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays/snp-genotyping-taqman-assays/custom-snp-assays.html?ICID=ta-lm-custom%20taqman%20snp%20assay-Single%20Tube%20Custom%20TaqMan%C2%AE%20SNP%20Genotyping%20Assays). If the sequence was not human, make sure to select non-human at the species filter step. Nonhuman assays do not get functionally tested.

Can I analyze a triallelic SNP?

Yes, you can analyze a triallelic SNP using paired TaqMan SNP Genotyping Assays. Please refer to this application note for more information (https://tools.thermofisher.com/content/sfs/brochures/cms_055168.pdf).

How do I find positive control samples for my TaqMan SNP Genotyping Assays?

We do not provide control samples. However, Coriell has a large gDNA repository and you may be able to find controls there. Go to: http://ccr.coriell.org/ and choose “SNP Search”. Enter your rs number or gene name. If there are samples available you will see them in the table, such as in this example below. Browse the different genotypes for your desired controls. If a control is not available, you can have one synthesized using GeneArt Gene Synthesis.

Can I use preamplification with the TaqMan SNP Genotyping Assays?

There is a preamplification protocol included with our TaqMan Sample-to-SNP Kit. This is designed to work with a lysate sample.

How much gDNA should I use with my TaqMan SNP Genotyping Assay?

We recommend using ~1-20 ng of good-quality gDNA per well. The gDNA should have an A260/A280 ratio of ~1.7-1.9. It is also important to try to add the same amount of gDNA to every well.

How do I submit a sequence for a custom TaqMan SNP Genotyping Assay?

You can use our Custom Assay Design Tool (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays/snp-genotyping-taqman-assays/custom-snp-assays.html?ICID=ta-lm-custom%20taqman%20snp%20assay-Single%20Tube%20Custom%20TaqMan%C2%AE%20SNP%20Genotyping%20Assays) to submit your SNP sequence for an assay design. Alternatively, you can also use Primer Express Software to design an assay. The DNA sequence needs to have at least 30 bases on each side of the SNP site. The more sequence you provide, the greater chance you have of the tool creating a passing design. The ideal sequence length is ~ 200 bases on either side of the SNP site. For the best-performing assay, we recommend prescreening the sequence for other SNPs, repeats, and regions of low complexity. These variations should be masked prior to submitting the sequence. This will prevent the design tool from designing the primers or probe over those regions, which could reduce the efficiency of the assay if they were used. For more details on how to screen and mask the sequence, please follow the guidelines here (https://tools.thermofisher.com/content/sfs/manuals/cms_042307.pdf).

How should I dilute the TaqMan SNP Genotyping Assays?

We recommend diluting the 40X and 80X TaqMan SNP Genotyping Assays to a 20X working stock with 1X TE buffer. The 1X TE buffer should be 10 mM Tris-HCl, 1 mM EDTA, pH 8.0, and be made using DNase-free, sterile-filtered water.

Which type of probes are preferred for allelic discrimination (AD) assays: TAMRAor MGB probes?

Both MGB and TAMRA probes can be used, but for AD assays MGB probes have some advantages. MGB probes have a minor groove-binder moiety on the 3' end, which enhances Tm. Therefore MGB probes have higher Tms for the exact same sequence as compared to a standard TaqMan TAMRA probe.

This Tm difference is advantageous for AD assays. The shorter the probe is, the greater the Tm differential between matched and mismatched probes. There may be many other applications that a smaller probe can be used for (for example, designing a probe over a small conserved region of sequence). The overall fluorescence in the reaction is decreased, as well, because the MGB moiety is nonfluorescent, which may help with the discrimination.

For more information on the design of TaqMan MGB probes for Allelic Discrimination/SNP assays using Primer Express software, please refer to the tutorial “Designing TaqMan MGB Probe and Primer Sets for Allelic Discrimination Assays Using Primer Express Software” (Cat. No. 4370991). You can find a copy on our website by entering this title or the Catalog No. as keywords in the main Search field.

What does the context sequence in the AIF for TaqMan Drug Metabolism Genotyping Assays indicate?

The context sequence indicates the nucleotide sequence surrounding the probe. The SNP is annotated in brackets as follows: [allele 1_VIC labeled/allele 2_FAM labeled]. As an example the context file may look like: CTCCTCTGACACTGTCGCTTCTCCA[T/C]GGCATTAGATTTTCAGTCCTGCTCA. Please note: 25 nucleotides on each side of the SNP site is included in the context sequence. In this example, the SNP [T/C] can be read as T = allele 1 and is VIC dye labeled, C = Allele 2 and is FAM dye labeled. The context sequence of the assay is always shown in the forward orientation, regardless of the strand on which the SNP is typically reported. It is important to compare the context sequence of the SNP assay to the SNP sequence in the NCBI’s dbSNP database to determine which dye is associated with the minor allele.

What do all of the columns mean in the Assay Index File (AIF) that comes with each TaqMan Drug Metabolism Assay?

A detailed description that highlights all columns relevant to the DMEs can be found in the "Understanding Your Shipment Reference Guide" (https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0017153_UnderstandYourShipment_RG.pdf).

My TaqMan Drug Metabolism Genotyping Assay shows some samples clustering with the no template controls. What does this mean?

A sample that clusters with the no template control may indicate that you did not add either DNA or an assay reagent to the reaction well. You may want to redo the experiment. A sample that clusters with the no template control may also indicate the presence of two null alleles in the individual. It is recommended that you repeat the experiment. If the sample again clusters with the no template control, you may want to run a gene dosage assay. All samples that did not amplify in the SNP assay may have a copy number of 0 in the gene dosage assay. Use a positive control to ensure everything else is working.

My TaqMan Drug Metabolism Genotyping Assay cluster plot shows more than three clusters (outliers).  What does this mean?

A cluster plot with more than three clusters may mean that there is an additional SNP under the TaqMan probe or there may be a copy number polymorphism. It is recommended that you perform the assay again to verify the extra cluster. If the extra cluster persists with the same samples, you may want to perform comparative sequencing on the outlier samples to identify if there are any other SNPs present. A persisting extra cluster may also indicate a copy number polymorphism. Homozygous individuals with extra copy numbers of the gene will generally cluster with the homozygous cluster. Only heterozygous individuals tend to fall into a 4 cluster that lies between the heterozygote cluster and one of the homozygous clusters. Therefore, since homozygous copy number variation is somewhat hidden, gene dosage assays should be performed on all samples to determine which individuals carry the extra copies of the gene.

My TaqMan Drug Metabolism Genotyping Assay shows only one cluster. What does this mean?

The presence of a single cluster may indicate that the allele has a very low minor allele frequency (i.e., less than 5% is a rare allele). You should verify the minor allele frequency listed on our website. If there is an allele nomenclature associated with the assay, you may want to refer to the reference paper associated with the polymorphism to determine what population size is needed to see the minor allele. Please note that the minor allele may only occur in certain populations. Visit the article "Interpreting Scatterplots in Genotyping Experiments" in the Real-Time PCR Learning Center (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-learning-center.html) for more information.

What controls do you recommend running with a TaqMan Drug Metabolism Genotyping Assay?

In addition to using a no template control, we suggest that you use a positive control (sample with a known SNP genotype). This will help you assess the performance of an assay. Unfortunately, we do not offer positive controls for this product line. Visit the Genotyping section of the Real-Time PCR Learning Center (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-learning-center.html) for tips on how to obtain positive controls for genotyping experiments.

Can I run all of the TaqMan SNP Genotyping Assays using the TaqMan Drug Metabolism Assay thermocycling protocol?

No, the TaqMan Drug Metabolism Assays thermocycling parameters are not optimized to run TaqMan Genotyping Assays. You should use the thermocycling parameters recommended for TaqMan Genotyping Assays.

What do the different numbers after the underscore, at the end of a TaqMan SNP assay ID, mean?

This is an indication of the version. An assay ID with an _30 would mean the third revision of that particular design (i.e. _10 was first version). For some of the DME assays, there is a capital letter with a number after it (i.e. _A0).

What is the key to running Allelic Discrimination and SNP assays, i.e. what makes it possible to discriminate something as small as a single base difference?

The key to Allelic Discrimination is the Tm difference between the perfectly matched and the mismatched probe and their respective binding affinities for the same sequence. There will be a Tm window in which the matched probe will be more likely than the mismatched probe to bind and be cleaved by the 5'-nuclease activity of the AmpliTaq Gold DNA polymerase. The competition for binding between these two probes favors the binding and cleavage of the matched probe, and use of TaqMan MGB probes make clean discrimination more likely. For additional information on TaqMan MGB probes and their use and design, please refer to User Bulletin “Primer Express v1.5 and TaqMan MGB Probes for Allelic Discrimination: All PCR Instruments”. Simply search for the title on our website to find a copy.

Why is the auto calling in the instrument software not working? What can I do?

If you are not getting calls in the instrument software, you can try the free TaqMan Genotyper Software (https://www.thermofisher.com/qpcrsoftware). Another option is the Genotyping App on the Thermofisher Cloud (https://www.thermofisher.com/cloud). These programs have improved algorithms which allow them to make calls that are often missed by the instrument software. In addition, make sure you are running a sufficient number of samples (more than 3), and include at least one NTC well which is labeled in the software.

I have imported experiment files into my study, can I now edit the assay IDs and/or sample IDs in the TaqMan Genotyper Software?

The software does not allow assay IDs or sample IDs to be modified. If a typo occurred or an edit is required, this change must be made in the original experiment file. The software does, however, allow you to create your own assay name and add additional information related to an assay or sample through Setup -->Assays or Setup -->Samples. 

I cannot find a pre-designed assay to my target. Do you have a custom option?

Targets of interest that are not covered by the current Applied Biosystems TaqMan SNP Genotyping collection can be submitted to Custom TaqMan SNP Assay design. 

The Custom TaqMan Assay Design Tool (CADT) is available on www.thermofisher.com. Order a custom TaqMan SNP Genotyping Assay by first entering a sequence with the SNP in brackets, for example [A/G], then submitting the chosen target sites for assay design. Upon notification of successful assay design by email, click the link in the message and add the desired custom assays to your shopping basket. 

CADT can be used to design assays targeting biallelic SNPs or insertion/deletion polymorphisms and multi‐nucleotide polymorphisms (MNPs) that are 6 bases or fewer in length. This tool can also be used to input and order primer and probe sequences of assays that have already been designed that contain FAM or VIC labels and MGB‐NFQ quenchers. 

Note that sequences must be SNP and repeat‐masked before submission to CADT. Additionally, the genome‐uniqueness for assays must first be established, because custom assays are not compared to the genome (e.g., by BLAT or BLASTn) to determine target specificity. Any target on the “unavailable list” (described on page 25) should not be submitted to CADT, because an assay may be designed but it will fail to function properly. For targets that present assay design challenges, contact our fee‐for‐design custom assay design service at custom.solutions@thermofisher.com.

When creating a Real-Time PCR assay for SNP genotyping, could I design it such that the SNP target sequence is included in one of the unlabeled PCR primers rather than in the labeled TaqMan probe?

This is not recommended. For best sensitivity in discriminating between alleles in endpoint analysis, the target polymorphism sequence should appear within the differentially-labeled probes. In our pre-designed TaqMan Assays for SNP Genotyping, the single nucleotide polymorphism is generally located within the middle-third of the TaqMan probe sequence.

When designing probes to perform Allelic Discrimination (SNP assays), are there any alternatives to using probes longer than 30bp in order to get the appropriate melting temperature?

Applied Biosystems TaqMan MGB (minor groove binder) probes would be appropriate for Allelic Discrimination/SNP Genotyping probe designs. TaqMan MGB probes have a minor groove binder at the end of the probe. This minor groove binder increases the Tm of probes, allowing the use of shorter probes. Consequently, the TaqMan MGB probes exhibit greater differences in Tm values between matched and mismatched probes, which provides more accurate allele discrimination.

For information on the design of TaqMan MGB probes for Allelic Discrimination/SNP assays using Primer Express software, please refer to our guide "Designing TaqMan MGB Probe and Primer Sets for Allelic Discrimination Assays Using Primer Express".

Safety and Handling

WARNING: Reproductive Harm - www.P65Warnings.ca.gov

For Research Use Only. Not for use in diagnostic procedures.