Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

Thermo Scientific™ M13/pUC Reverse Sequencing Primer (-46), 24-mer

Catalog No. ferso115
Change view
Click to view available options
Quantity:
10 μM, 42 μL
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Catalog No. Quantity
FERSO115 10 μM, 42 μL
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Catalog No. FERSO115 Supplier Thermo Scientific™ Supplier No. SO115
Only null left
Add to Cart
Add to Cart

Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.

Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

Primer Sequence: 5'-d(GAGCGGATAACAATTTCACACAGG)-3'

TRUSTED_SUSTAINABILITY

Specifications

Product Type Sequencing Primer
Content And Storage M13/pUC Reverse Sequencing Primer (-46), 24-mer, 10 μM (42 μL)

Store at –20°C.
Shipping Condition Dry Ice
Concentration 10 μM
Primer M13
Quantity 10 μM, 42 μL
Vector pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II
For Use With (Application) Sequencing
Form Liquid

For Research Use Only. Not for use in diagnostic procedures.

Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.