Learn More
Thermo Scientific™ pJET1.2 Forward Sequencing Primer, 23-mer
Description
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR
pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'
Related products
pJET1.2 Reverse Sequencing Primer, 24-mer (Cat. No. SO511)
Specifications
Specifications
| Product Type | Forward Sequencing Primer |
| Content And Storage | T3 promoter Sequencing Primer, 24-mer, 10 μM Store at –20°C. |
| Shipping Condition | Dry Ice |
| Concentration | 10 μM |
| Primer | pJET |
| Quantity | 10 μM |
| Vector | pJET1.2 |
| For Use With (Application) | Sequencing |
| Form | Liquid |
For Research Use Only. Not for use in diagnostic procedures.
By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.