Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More
  1. Home
  2. Products
  3. PCR Equipment and Supplies
  4. Oligonucleotides
  5. FERSO511

Thermo Scientific™ pJET1.2 Reverse Sequencing Primer, 24-mer

Catalog No. FERSO511
Change view
Click to view available options
Quantity:
10 μM, 84 μL
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Catalog No. Quantity
FERSO511 10 μM, 84 μL
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Catalog No. FERSO511 Supplier Thermo Scientific™ Supplier No. SO511
Only null left
Add to Cart
Add to Cart

Description

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related products
pJET1.2 Forward Sequencing Primer, 23-mer (Cat. No.SO501)

TRUSTED_SUSTAINABILITY

Specifications

Product Type Forward Sequencing Primer
Content And Storage pJET1.2 Forward Sequencing Primer, 23-mer, 10 μM (84 μL)

Store at –20°C.
Shipping Condition Dry Ice
Concentration 10 μM
Primer pJET
Quantity 10 μM, 84 μL
Vector pJET1.2
For Use With (Application) Sequencing
Form Liquid

For Research Use Only. Not for use in diagnostic procedures.

Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.