Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

Thermo Scientific™ SP6 promoter Sequencing Primer, 24-mer

Catalog No. FERSO117
Click to view available options
Quantity:
10 μM, 42 μL

Catalog No. FERSO117

Supplier: Thermo Scientific™ SO117

Only null left
Add to Cart
Add to Cart

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. This SP6 Promoter Sequencing Primer, 24-mer is complementary to the SP6 RNA Polymerase promoter region and is supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II

Promoter Sequence: 5'-d (CATACGATTTAGGTGACACTATAG)-3'

Related products
SP6 promoter Sequencing Primer, 18-mer (SO116)
T7 promoter Sequencing Primer, 20-mer (SO118)
T3 promoter Sequencing Primer, 17-mer (SO119)
T3 promoter Sequencing Primer, 24-mer (SO120)

Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated

TRUSTED_SUSTAINABILITY

Specifications

Promoter SP6, T3, T7
Product Type Sequencing Primer
Content And Storage SP6 promoter Sequencing Primer, 24-mer, 10 μM (42 μL)

Store at –20°C.
Shipping Condition Dry Ice
Concentration 10 μM
Primer SP6
Quantity 10 μM, 42 μL
Vector pTZ19R, pTZ57R, pBluescript II
For Use With (Application) Sequencing
Form Liquid

For Research Use Only. Not for use in diagnostic procedures.

Product Content Correction

Your input is important to us. Please complete this form to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Your feedback has been submitted: Thank you for helping us improve our website.