Thermo Scientific™ T3 promoter Sequencing Primer, 24-mer

Catalog No.	Quantity
FERSO120	10 μM, 42 μL

Catalog No. FERSO120 Supplier Thermo Scientific™ Supplier No. SO120

Description

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II

Promoter Sequence 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'

Related products
SP6 promoter Sequencing Primer, 18-mer (SO116)
T3 promoter Sequencing Primer, 17-mer (SO119)
SP6 promoter Sequencing Primer, 24-mer (SO117)
T7 promoter Sequencing Primer, 20-mer (SO118)

Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated

Specifications

• Promoter: SP6, T3, T7
• Product Type: Sequencing Primer
• Content And Storage: T3 promoter Sequencing Primer, 24-mer, 10 μM (42 μL)
  
  Store at –20°C.
• Shipping Condition: Dry Ice
• Concentration: 10 μM
• Primer: T3
• Quantity: 10 μM, 42 μL
• For Use With (Application): Sequencing
• Form: Liquid

For Research Use Only. Not for use in diagnostic procedures.