Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

Thermo Scientific™ T7 promoter Sequencing Primer, 20-mer

Catalog No. FERSO118
Change view
Click to view available options
Quantity:
10 μM
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Catalog No. Quantity
FERSO118 10 μM
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Catalog No. FERSO118 Supplier Thermo Scientific™ Supplier No. SO118
Only null left
Add to Cart
Add to Cart

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II

Promoter sequences 5'-d (TAATACGACTCACTATAGGG)-3'

Related products
T3 promoter Sequencing Primer, 17-mer (SO119)
SP6 promoter Sequencing Primer, 24-mer (SO117)
T3 promoter Sequencing Primer, 24-mer (SO120)
SP6 promoter Sequencing Primer, 18-mer (SO116)

Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated.

TRUSTED_SUSTAINABILITY

Specifications

Promoter SP6, T3, T7
Product Type Sequencing Primer
Content And Storage T7 promoter Sequencing Primer, 20-mer, 10 μM

Store at –20°C.
Shipping Condition Dry Ice
Concentration 10 μM
Primer T7
Quantity 10 μM
Vector pTZ19R, pTZ57R, pBluescript II
For Use With (Application) Sequencing
Form Liquid

For Research Use Only. Not for use in diagnostic procedures.

Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.