Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

Invitrogen™ GeneArt™ CRISPR Nuclease Vector with CD4 Enrichment Kit (with competent cells) Non-distribution product as customer accommodation.

Simple, ready-to-use, all-in-one expression vector system for CRISPR-based genome editing.

Manufacturer:  Invitrogen™ A21177

Catalog No. A21177


Add to cart

Alert:

For research use only. Not for use in diagnostic procedures.


Includes:
  • CRISPR CD4 Nuclease Vector, linearized
  • 10X Oligonucleotide Annealing Buffer
  • DNase/RNase-free Water
  • 5X Ligation Buffer
  • T4 DNA Ligase
  • U6 Forward Sequencing Primer
  • Control Double-stranded Oligonucleotide
  • OneShot™ TOP10 Chemically Competent Cells

Description

Description

Simple, ready-to-use, all-in-one expression vector system for expression of the functional components needed for CRISPR-Cas9 genome editing in mammalian cells with a CD4 reporter. Competent cells included for added convenience and highest cloning efficiencies.

GeneArt CRISPR Nuclease Vector with CD4 Enrichment Kit is a vector system for expression of the functional components needed for CRISPR-Cas9 genome editing in mammalian cells with a CD4 reporter. The CD4 reporter enables bead-based enrichment, an option for magnetic bead-based sorting/enrichment of Cas9 & CRISPR expressing cells using Dynabeads CD4 magnetic beads. Transfection efficiency can also be tracked using anti-CD4 fluorescent antibodies. The linearized GeneArt CRISPR nuclease vectors provide a rapid and efficient way to clone double-stranded oligonucleotides encoding a crRNA representing a desired target into an expression cassette that allows sequence-specific targeting of the Cas9 nuclease. A version with competent cells is also available (Cat. No. A21177).


The GeneArt™ CRISPR Nuclease Vector system with competent cells offers
  • Easy-to-design genome engineering system
  • Affordable, ready-to-use cloning vectors
  • Enrichment for hard to transfect or difficult to modify cell lines
For research use only. Not for use in diagnostic procedures.

Certifications

CoA

Compliance

CoA

Recommended Storage

Store in freezer (-5 to -30°C)

Specifications

Specifications

Genome editing, gene editing, disease modeling, stem cell research, drug discovery, cell based therapies, gene therapy, gene function, gene tagging, pathway engineering, metabolic engineering, protein production
Store in freezer (-5 to -30°C)
GeneArt™ CRISPR Nuclease Vector with CD4 Enrichment Kit (with competent cells), 10 rxns, Restriction enzyme/MCS Cloning Method, Restriction Enzyme/MCS Cloning Method, Vector System for Expression of the Functional Components
U6 Forward: 5A€²- GGACTATCATATGCTTACCG -3A€²
GeneArt™ CRISPR Nuclease Vector with CD4 Enrichment Kit (with Competent Cells)
10 rxn(s)
10
Transfection
CRISPR CD4 nuclease vector, linearized, 10X oligonucleotide annealing buffer, DNase/RNase-free water, 5X ligation buffer, T4 DNA ligase, U6 forward sequencing primer, control double-stranded oligonucleotide, OneShot™ TOP10 chemically competent cells
CMV, U6
CD4
CD4 fusion
Documents
Provide Content Correction

The Fisher Scientific Encompass Program offers items which are not part of our distribution portfolio. These products typically do not have pictures or detailed descriptions. However, we are committed to improving your shopping experience. Please use the form below to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Cancel Submit