Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

Invitrogen™ GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit Non-distribution product as customer accommodation.

Simple, ready-to-use, all-in-one expression vector system for CRISPR-based genome editing.

Manufacturer:  Invitrogen™ A21174

Catalog No. A21174


Add to cart

Alert:

For research use only. Not for use in diagnostic procedures.


Includes: · CRISPR OFP Nuclease Vector, linearized
· 10X Oligonucleotide Annealing Buffer
· DNase/RNase-free Water
· 5X Ligation Buffer
· T4 DNA Ligase
· U6 Forward Sequencing Primer
· Control Double-stranded Oligonucleotide

Description

Description

Simple, ready-to-use, all-in-one expression vector system for expression of the functional components needed for CRISPR-Cas9 genome editing in mammalian cells with an orange fluorescent protein (OFP) reporter. GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit is a vector system for expression of the functional components needed for CRISPR-Cas9 genome editing in mammalian cells with an orange fluorescent protein (OFP) reporter. The OFP reporter allows for fluorescence-based tracking of transfection efficiency, as well as FACS-based sorting/enrichment of Cas9 and CRISPR expressing cells. The linearized GeneArt™ CRISPR nuclease vectors provide a rapid and efficient way to clone double-stranded oligonucleotides encoding a crRNA representing a desired target into an expression cassette that allows sequence-specific targeting of the Cas9 nuclease. A version with competent cells is also available (Cat. No. A21178).

The GeneArt™ CRISPR Nuclease Vector system offers:

· Easy-to-design genome engineering system
· Affordable, ready-to-use cloning vectors
· Enrichment for hard to transfect or difficult to modify cell lines


For research use only. Not for use in diagnostic procedures.

Certifications

CoA

Compliance

CoA

Recommended Storage

Store in freezer (-5 to -30°C)

Specifications

Specifications

Genome editing, gene editing, disease modeling, stem cell research, drug discovery, cell based therapies, gene therapy, gene function, gene tagging, pathway engineering, metabolic engineering, protein production
Store in freezer (-5 to -30°C)
GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit, 10 rxns, Restriction enzyme/MCS Cloning Method, Restriction Enzyme/MCS Cloning Method, Vector System for Expression of the Functional Components Needed for CRISPR/Cas9 Genome Editing
U6 Forward: 5A€²- GGACTATCATATGCTTACCG -3A€²
GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit
10 rxn(s)
10
Transfection
CRISPR OFP Nuclease Vector, linearized: 10X oligonucleotide annealing buffer, DNase/RNase-free water, 5X ligation buffer, T4 DNA ligase, U6 forward sequencing primer, control double-stranded oligonucleotide
CMV, U6
OFP
OFP fusion
Documents
Provide Content Correction

The Fisher Scientific Encompass Program offers items which are not part of our distribution portfolio. These products typically do not have pictures or detailed descriptions. However, we are committed to improving your shopping experience. Please use the form below to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Cancel Submit