Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

Invitrogen™ T7 Promoter Primer

Catalog No. N56002
Encompass_Preferred
Change view
Click to view available options
Quantity:
2 μg
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Catalog No. Quantity
N56002 2 μg
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Catalog No. N56002 Supplier Invitrogen™ Supplier No. N56002
Only null left
Add to Cart
Edge
Add to Cart

Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available.

Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available. The T7 Promoter Primer is recognized by T7 RNA polymerase and is commonly used to regulate gene expression of recombinant proteins. Subsequent recombinant proteins may be used for further downstream research applications.

T7 Promoter Primer features include:
• Desalted and purified by gel filtration
• Assayed for function by PCR amplification
• Provided in 2 μg quantity

Applications
• Sanger sequencing
• PCR amplification

T7 Primer Sequence: 5´- TAATACGACTCACTATAGGG- 3´

Order Info

Shipping Conditions: Room Temperature

TRUSTED_SUSTAINABILITY

Specifications

Promoter T7
Product Type Primer
Content And Storage • T7 Promoter Primer (2 μg)

Store in Freezer at –20°C.
Guaranteed stable for 6 months when properly stored.
Primer Length 20-mer
Primer Sequence 5 ́d[TAATACGACTCACTATAGGG]3 ́
Purification Method Gel-purified
Shipping Condition Room Temperature
Primer T7
Quantity 2 μg
For Use With (Application) PCR Amplification
Form Lyophilized
Show More Show Less
WARNING: Reproductive Harm - www.P65Warnings.ca.gov

For Research Use Only. Not for use in diagnostic procedures.

Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.