Learn More
Invitrogen™ T7 Promoter Primer
Primers for PCR amplification that complement many vectors
Supplier: Invitrogen™ N56002

Description
- Desalted and purified by gel filtration
- Assayed for function by PCR amplification
- Provided in 2μg quantity
- T7: 5'- TAATACGACTCACTATAGGG- 3'
Sanger Sequencing, Sanger Sequencing Technology & Accessories, Sequencing
Order Info
Shipping Conditions: Room Temperature
Specifications
T7 | |
Primer are supplied lyophilized in 10 mM Tris-HCl, pH 7.5, 1 mM EDTA. Store at -20°C. Guaranteed stable for 6 months when properly stored. | |
5´d[TAATACGACTCACTATAGGG]3´ | |
Room Temperature | |
2 μg | |
Lyophilized |
Primer | |
20-mer | |
Gel-purified | |
T7 | |
PCR Amplification |
The Fisher Scientific Encompass Program offers items which are not part of our distribution portfolio. These products typically do not have pictures or detailed descriptions. However, we are committed to improving your shopping experience. Please use the form below to provide feedback related to the content on this product.
For Research Use Only. Not for use in diagnostic procedures.