Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

Promega pUC/M13 Sequencing Primers

Catalog No. PRQ5601 Shop All Promega Corporation Products
Click to view available options
Sequence:
CGCCAGGGTTTTCCCAGTCACGAC

Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. They also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors.

  • Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids
  • Can sequence other lacZ-containing plasmids such as the pGEM(R)-Z and pGEM(R)-Zf Vectors
  • Supplied at a concentration of 10μg/ml

Specifications

Concentration 10μg/mL
For Use With (Application) For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing
Product Type Primer
Quantity 2 μg
Sequence CGCCAGGGTTTTCCCAGTCACGAC
Product Content Correction

Your input is important to us. Please complete this form to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Your feedback has been submitted: Thank you for helping us improve our website.