Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More
  1. Home
  2. Products
  3. Biochemical Reagents
  4. DNA Reagents
  5. DNA Sequencing
  6. Promega pUC/M13 Sequencing Primers

Promega pUC/M13 Sequencing Primers

Catalog No. PRQ5601 Shop All Promega Corporation Products
Change view
Click to view available options
Sequence:
CGCCAGGGTTTTCCCAGTCACGAC
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Catalog No. Sequence
PRQ5601 CGCCAGGGTTTTCCCAGTCACGAC
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Catalog No. PRQ5601 Supplier Promega Supplier No. Q5601
Only null left
Add to Cart
Add to Cart

Description

Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. They also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors.

  • Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids
  • Can sequence other lacZ-containing plasmids such as the pGEM(R)-Z and pGEM(R)-Zf Vectors
  • Supplied at a concentration of 10μg/ml

Specifications

Concentration 10μg/mL
For Use With (Application) For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing
Product Type Primer
Quantity 2 μg
Sequence CGCCAGGGTTTTCCCAGTCACGAC
Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.