Isoflavonoids
![Medchemexpress LLC Inactive ASO (in vivo) sodium | [CCTATAGGACTATCCAGGAA] | 100 MG](https://assets.fishersci.com/TFS-Assets/CCG/product-images/default.jpg-250.jpg)
Medchemexpress LLC Inactive ASO (in vivo) sodium | [CCTATAGGACTATCCAGGAA] | 100 MG
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen.
- Contains thiophosphate skeleton modification
- Contains MOE modification
- Cytosine is 5' methylcytosine
Medchemexpress LLC Inactive ASO (in vivo) sodium | CCTATAGGACTATCCAGGAA | 50 MG
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide (ASO). ASOs are a class of oligonucleotide molecules, typically 20-30 bases long, used to interfere with or regulate gene expression. This specific product is not targeted in the rodent genome and can be utilized as a negative control for Tofersen. It features thiophosphate skeleton modification and MOE modification, with cytosine in Inactive ASO (in vivo) being 5' methylcytosine.
- Used as a negative control for Tofersen
- Features thiophosphate skeleton modification
- Includes MOE modification
- Contains 5' methylcytosine
Medchemexpress LLC Inactive ASO (in vivo) sodium | CCTATAGGACTATCCAGGAA | 5 MG
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide (ASO), typically 20-30 bases long, designed to interfere with or regulate gene expression. This specific ASO serves as a negative control for Tofersen, as it is not targeted in the rodent genome.
- Oligonucleotide molecules
- Interferes with or regulates gene expression
- Not targeted in the rodent genome
- Serves as a negative control for Tofersen
- Features thiophosphate skeleton modification
- Includes MOE modification
- Contains 5' methylcytosine
Medchemexpress LLC Inactive ASO (in vivo) sodium | CCTATAGGACTATCCAGGAA | 1 MG
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide (ASO) used to interfere with or regulate gene expression. This ASO is not targeted within the rodent genome and serves as a negative control for Tofersen. It features thiophosphate skeleton modification and MOE modification, and its cytosine is 5' methylcytosine.
- Inactive Antisense Oligonucleotide (ASO)
- Negative control for Tofersen
- Thiophosphate skeleton modification
- MOE modification
- 5' methylcytosine as cytosine
- White to off-white solid appearance
- Purity of 92.18%
Medchemexpress LLC Genistein 7-sulfate sodium | 99.9% | 372.28 | 1 MG
Genistein 7-sulfate sodium is a metabolite of genistein. It has the ability to reduce the activity of estrogen agonists in MCF-7 cells and can also promote the growth of MCF-7 cells at concentrations of 10 μM and above.
- Metabolite of genistein
- Reduces activity of estrogen agonists in MCF-7 cells
- Promotes growth of MCF-7 cells at concentrations of 10 μM and above
- Used in research on effects on estrogen agonists and MCF-7 cell growth
Medchemexpress LLC Sodium formononetin-3'-sulfonate | 949021-68-5 | 99.8% | C16H11NaO7S | 10MG
Sodium formononetin-3'-sulfonate is a water-soluble sulfonate derivative of formononetin intended for research applications. It is provided as a high-purity solid optimized for biochemical and cellular experiments where improved aqueous solubility and stability relative to the parent isoflavone are required. Storage and solubility guidance should be followed for best results.
- High reported purity (≈99.8%).
- Solid form with options for solution preparations.
- Readily soluble in DMSO (100 mg/mL) and water (25 mg/mL) with ultrasonic aid.
- Recommended storage: refrigerated sealed for solid; frozen in solvent for long-term storage.
- Suitable for biochemical and cellular oxidative stress studies.
Medchemexpress LLC Sodium formononetin-3'-sulfonate | 949021-68-5 | 99.8% | 10 MM * 1 ML
Sodium formononetin-3'-sulfonate (Sul-F) is a water-soluble derivative of formononetin. Research indicates that Sul-F significantly prevents the elevation of ST-segment levels and decreases several serum markers associated with myocardial injury. It is also noted for its favorable water solubility, lipid-lowering, and liver-protection activities, making it suitable for various research applications.
- Prevents elevation of ST-segment level.
- Decreases creatine kinase-MB, lactate dehydrogenase, alanine aminotransferase, and cardiac troponin T levels.
- Reduces myocardium necrosis scores.
- Elevates expression of endogenous antioxidant defense enzymes.
- Degrades lipid peroxidation products.
- Improves energy metabolism of cardiac mitochondria.
- Attenuates cardiocyte apoptosis.
- Exhibits good lipid-lowering and liver-protection activities.
eMolecules Formononetin-7-O-beta-D-glucuronide, sodium salt | 18524-03-3 | | 25mg
Apollo Scientific | Formononetin-7-O-beta-D-glucuronide, sodium salt | 25mg | 603091180 | BICL4100 | 99.000 | 18524-03-3 | | 466.374 | C22H19NaO10
If you are unable to find the chemical you are looking for, make sure you are logged into your fishersci.com account and click on the following link:
eMolecules Building Block Tool