Trays
- (1)
- (3)
- (2)
- (19)
- (6)
- (4)
- (1)
- (24)
- (1)
- (8)
- (9)
- (5)
- (12)
- (9)
- (56)
- (7)
- (15)
- (1)
- (2)
- (1)
- (10)
- (2)
- (11)
- (3)
- (6)
- (7)
- (4)
- (2)
- (1)
- (11)
- (1)
- (37)
- (4)
- (8)
- (3)
- (9)
- (1)
- (5)
- (4)
- (3)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (7)
- (4)
- (17)
- (6)
- (7)
- (1)
- (1)
- (1)
- (2)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (2)
- (1)
- (2)
- (1)
- (3)
- (1)
- (2)
- (2)
- (2)
- (1)
- (1)
- (2)
- (13)
- (1)
- (1)
- (1)
- (2)
- (2)
- (3)
- (1)
- (2)
- (2)
- (1)
- (2)
- (1)
- (1)
- (2)
- (1)
- (1)
- (1)
- (4)
- (1)
- (1)
- (2)
- (2)
- (1)
- (1)
- (2)
- (1)
- (1)
- (2)
- (1)
- (2)
- (1)
- (1)
- (10)
- (1)
- (1)
- (1)
- (4)
- (1)
- (1)
- (1)
- (2)
- (3)
- (1)
- (2)
- (1)
- (3)
- (1)
- (4)
- (1)
- (1)
- (1)
- (2)
- (1)
- (2)
- (3)
- (2)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (3)
- (1)
- (2)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (1)
- (2)
- (2)
- (1)
- (2)
- (1)
- (4)
- (1)
- (2)
- (1)
- (2)
- (1)
- (3)
- (1)
- (3)
- (2)
- (1)
- (1)
- (2)
- (2)
- (3)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (4)
- (1)
- (2)
- (1)
- (2)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (3)
- (5)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (2)
- (1)
- (1)
- (1)
- (2)
- (1)
- (1)
- (2)
- (1)
- (1)
- (4)
- (2)
- (1)
- (7)
- (3)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (5)
- (1)
- (1)
- (1)
- (1)
- (1)
- (7)
- (1)
- (2)
- (2)
- (3)
- (1)
- (1)
- (1)
- (2)
- (6)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (9)
- (7)
- (4)
- (1)
- (1)
- (1)
- (2)
- (1)
- (2)
- (1)
- (2)
- (8)
- (4)
- (2)
- (2)
- (1)
- (1)
- (1)
- (1)
- (2)
- (1)
- (2)
- (2)
- (7)
- (2)
- (1)
- (1)
- (2)
- (4)
- (6)
- (1)
- (1)
- (1)
- (4)
- (2)
- (1)
- (1)
- (3)
- (2)
- (1)
- (3)
- (2)
- (1)
- (3)
- (1)
- (4)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (2)
- (1)
- (1)
- (1)
- (1)
- (2)
- (1)
- (5)
- (1)
- (1)
- (9)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (2)
- (1)
- (1)
Filtered Search Results
PHYTO AB INC PAM68 Antibody Immunogen: AT4G19100 Background: PAM68 is a conserved integral membrane protein which interacts with several PSII core proteins and known PSII assembly factors. 150ug/EA
PhytoAB Inc. is a contract research organization and plant antibody R&D based services and products supplier. PhytoAB is privately owned company headquatered in the San Francisco Bay Area of California, USA. PhytoAB specializes in antibody production for plant scientic usage and customized services, focus on the current need of plant antibodies to assist the further investigation of the current booming results from deep genome sequencing and increasing protomics studies. We have specialized R&D and customer services teams to fulfill the needs of botany & plant sciences research and industry world wide with high quality, professional and cutting edge services, and offering complete products usage guidance and suggestions for related problem solutions.
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
PHYTO AB INC PsbC Antibody Immunogen: ATCG00280 Background: CP43 contains six transmembrane alpha helices and five hydrophilic loops that connect the membrane-spanning domains. 150ug/EA
PhytoAB Inc. is a contract research organization and plant antibody R&D based services and products supplier. PhytoAB is privately owned company headquatered in the San Francisco Bay Area of California, USA. PhytoAB specializes in antibody production for plant scientic usage and customized services, focus on the current need of plant antibodies to assist the further investigation of the current booming results from deep genome sequencing and increasing protomics studies. We have specialized R&D and customer services teams to fulfill the needs of botany & plant sciences research and industry world wide with high quality, professional and cutting edge services, and offering complete products usage guidance and suggestions for related problem solutions.
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
PHYTO AB INC PSBB Antibody Immunogen: ATCG00680 Background: CP47 is one of the components of the core complex of PSII. 150ug/EA
PhytoAB Inc. is a contract research organization and plant antibody R&D based services and products supplier. PhytoAB is privately owned company headquatered in the San Francisco Bay Area of California, USA. PhytoAB specializes in antibody production for plant scientic usage and customized services, focus on the current need of plant antibodies to assist the further investigation of the current booming results from deep genome sequencing and increasing protomics studies. We have specialized R&D and customer services teams to fulfill the needs of botany & plant sciences research and industry world wide with high quality, professional and cutting edge services, and offering complete products usage guidance and suggestions for related problem solutions.
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
CUBE BIOTECH SMALP BZ35; 1 g
1g of nanodisc copolymer SMALP BZ35 for the stabilization of membrane proteins outside the cell
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
PHYTO AB INC PsaC Antibody Immunogen: ATCG01060 Background: PsaC is a PSI subunit exposed to the stromal side of PSI and provides the ligands for two [4Fe-4S] clusters, FA and FB. 150ug/EA
PhytoAB Inc. is a contract research organization and plant antibody R&D based services and products supplier. PhytoAB is privately owned company headquatered in the San Francisco Bay Area of California, USA. PhytoAB specializes in antibody production for plant scientic usage and customized services, focus on the current need of plant antibodies to assist the further investigation of the current booming results from deep genome sequencing and increasing protomics studies. We have specialized R&D and customer services teams to fulfill the needs of botany & plant sciences research and industry world wide with high quality, professional and cutting edge services, and offering complete products usage guidance and suggestions for related problem solutions.
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Santa Cruz Biotechnology ASGPR2/Asialoglycoprotein Receptor 2/ASGR2 Antibody (B-4) 200 µg/ml
Small and Specialty Supplier Partner
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
ASGPR2/Asialoglycoprotein Receptor 2/ASGR2 Antibody (B-4) is a mouse monoclonal IgG1 κ, cited in 1 publications, provided at 200 µg/mlraised against amino acids 81-135 mapping within an internal region of ASGPR2 of human originASGPR2/Asialoglycoprotein Receptor 2/ASGR2 Antibody (B-4) is recommended for detection of ASGPR2 of human origin by WB, IP, IF, IHC(P) and ELISA
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Cusabio Technology LLC Rat Dihydrotestosterone,DHT ELISA Kit
Small and Specialty Supplier Partner
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
This Rat DHT ELISA Kit was designed for the quantitative measurement of Rat DHT protein in serum, plasma, tissue homogenates. It is a Competitive ELISA kit, its detection range is 10 pg/mL-2000 pg/mL and the sensitivity is 5 pg/mL. One kit contains 96 wells.
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
PHYTO AB INC PHYB Antibody Immunogen: AT2G18790 Background: PHYB is a red far red photoreceptor involved in the regulation of de-etiolation. It exists in two inter-convertible forms Pr and Pfr (active). 150ug/EA
PhytoAB Inc. is a contract research organization and plant antibody R&D based services and products supplier. PhytoAB is privately owned company headquatered in the San Francisco Bay Area of California, USA. PhytoAB specializes in antibody production for plant scientic usage and customized services, focus on the current need of plant antibodies to assist the further investigation of the current booming results from deep genome sequencing and increasing protomics studies. We have specialized R&D and customer services teams to fulfill the needs of botany & plant sciences research and industry world wide with high quality, professional and cutting edge services, and offering complete products usage guidance and suggestions for related problem solutions.
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Sklar Instruments Steelware Sklar Microscopy Surgical 1/EA
Steelware Sklar Microscopy Surgical 1/EA
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Grainger SHCS Steel 8-32 1/2 L PK100
SHCS Steel 8-32 1/2 L PK100
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
BIORBYT LLC TransthyretinF87M/L110MHumanRe
CategoryProteins.MolecularWeight13.7kDa
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Gene Tools LLC CCTCTTACCTCAGTTACAATTTATA
Small and Specialty Supplier Partner
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
NC3823264 CCTCTTACCTCAGTTACAATTTATA
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Scientific Plastics TRAY 11 X 9 X 2 NATURAL
Small and Specialty Supplier Partner
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
NC3833950 TRAY 11 X 9 X 2 NATURAL
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
MOTION EDRN63M4/CICIID2 GEARMOTOR
NC3880859 EDRN63M4/CICIID2 GEARMOTOR
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
AARON CHEMICALS LLC
NC3925892 BISDIISOPROPYLAMINO2-CYANOE
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More