Thermo Scientific™ M13/pUC Reverse Sequencing Primer (-46), 24-mer

Description

Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.

Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

Primer Sequence: 5'-d(GAGCGGATAACAATTTCACACAGG)-3'

Specifications

• Product Type: Sequencing Primer
• Content And Storage: M13/pUC Reverse Sequencing Primer (-46), 24-mer, 10 μM (42 μL)
  
  Store at –20°C.
• Shipping Condition: Dry Ice
• Concentration: 10 μM
• Primer: M13
• Quantity: 10 μM, 42 μL
• Vector: pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II
• For Use With (Application): Sequencing
• Form: Liquid

For Research Use Only. Not for use in diagnostic procedures.