Learn More
Thermo Scientific™ M13/pUC Reverse Sequencing Primer (-46), 24-mer
Description
Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR
Primer Sequence: 5'-d(GAGCGGATAACAATTTCACACAGG)-3'
Specifications
Specifications
| Product Type | Sequencing Primer |
| Content And Storage | M13/pUC Reverse Sequencing Primer (-46), 24-mer, 10 μM (42 μL) Store at –20°C. |
| Shipping Condition | Dry Ice |
| Concentration | 10 μM |
| Primer | M13 |
| Quantity | 10 μM, 42 μL |
| Vector | pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II |
| For Use With (Application) | Sequencing |
| Form | Liquid |
For Research Use Only. Not for use in diagnostic procedures.
By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.