Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More
  1. Home
  2. Products
  3. Biochemical Reagents
  4. DNA Reagents
  5. DNA Sequencing
  6. PRQ4461

Promega pTARGET™ Sequencing Primer

Catalog No. PRQ4461
Click to view available options
Quantity:
2 μg

Description

Designed for sequencing inserts cloned into the pTARGET™ Mammalian Expression Vector

  • Designed for Sequencing Inserts Cloned into the pTargeT™ Mammalian Expression Vector
  • Hybridizes to the region of the lacZ gene at nucleotides 1367-1344 on the pTargeT™ Vector

Specifications

Concentration 10ng/μL
Content And Storage -30°C to -10°C
For Use With (Application) For sequencing inserts cloned into the pTARGET™ mammalian expression vector
Product Type Primer
Quantity 2 μg
Sequence TTACGCCAAGTTATTTAGGTGACA
Product Content Correction

Your input is important to us. Please complete this form to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Your feedback has been submitted: Thank you for helping us improve our website.