Isoflavonoids
Medchemexpress LLC Puerarin (Standard) | 3681-99-0 | 99.41% | 416.38 | 50 MG
Puerarin (Standard) is the analytical standard of Puerarin, intended for research and analytical applications. This isoflavone, extracted from Radix puerariae, functions as a 5-HT2C receptor antagonist.
- It serves as the analytical standard for Puerarin.
- It is suitable for research and analytical applications.
- The compound is an isoflavone isolated from Radix puerariae.
- It acts as a 5-HT2C receptor antagonist.
- It is commonly utilized in qualitative, quantitative, and methodological research experiments, including techniques like HPLC, GC, and MS.
Medchemexpress LLC Inactive ASO (in vivo) sodium | [CCTATAGGACTATCCAGGAA] | 100 MG
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen.
- Contains thiophosphate skeleton modification
- Contains MOE modification
- Cytosine is 5' methylcytosine
Apexbio Technology LLC Biochanin A 491-80-5 10mM (in 1mL DMSO)
Biochanin A (CAS number 491-80-5) is a naturally derived inhibitor of fatty acid amide hydrolase (FAAH) an enzyme responsible for metabolizing the endocannabinoid anandamide (AEA) In vitro studies show Biochanin A inhibits FAAH-mediated hydrolysis of AEA with IC50 values of 1 8 M (mouse) 1 4 M (rat) and 2 4 M (human) without affecting CB1 CB2 receptors or FAAH-2 In animal models Biochanin A attenuates formalin-induced phosphorylation of spinal extracellular signal-regulated kinase an effect reversible by CB1 receptor antagonist AM251 Biochanin A thus serves as a useful tool compound in pain regulation and endocannabinoid research
Cambridge Isotope Laboratories Daidzein (3 5 8-D3 97%) 60 ug/mL in acetonitrile-D3 2 x 1 2 mL
Daidzein (3 5 8-D3 97%) 60 ug/mL in acetonitrile-D3 2 x 1 2 mL
Medchemexpress LLC Biochanin A | 491-80-5 | C16H12O5 | 1 ML
Biochanin A is a naturally occurring fatty acid amide hydrolase (FAAH) inhibitor. It inhibits FAAH with IC50s of 1.8 μM for mouse, 1.4 μM for rat, and 2.4 μM for human FAAH.
- Inhibits FAAH, autophagy, and endogenous metabolite pathways.
- Relevant for neurological disease and cancer research.
- Targets metabolic enzyme/protease and neuronal signaling pathways.
- Storage for powder: -20°C for 3 years, 4°C for 2 years.
- Storage in solvent: -80°C for 2 years, -20°C for 1 year.
Sigma Aldrich Fine Chemicals Biosciences Genistein synthtic 98 HPL100MG
Genistein is an isoflavonoid present among Leguminosae family of plants. It is structurally similar to estrogen (estradiol-17).
![Alkali Scientific Genistein [4',5,7 Trihydroxyisoflavone], 100 Mg](https://assets.fishersci.com/TFS-Assets/CCG/product-images/5000661495.jpg-250.jpg)
Alkali Scientific Genistein [4',5,7 Trihydroxyisoflavone], 100 Mg
Genistein (4',5,7 Trihydroxyisoflavone), provided in a 100mg quantity, is a potent isoflavone used primarily as a kinase inhibitor in biochemical research. It is widely utilized in cancer research to block kinase-mediated signaling pathways that drive tumor progression and metastasis. Genistein also exerts antioxidant and anti-inflammatory effects, making it a candidate for therapeutic use in conditions such as cardiovascular diseases and autoimmune disorders. In laboratory studies, it is used to investigate the role of tyrosine kinases in cell signaling, protein function, and cellular responses to external stimuli. Genistein is particularly valuable in examining the effects of kinase inhibition in various disease models.
Medchemexpress LLC Sophoricoside | 152-95-4 | 432.38 | 250 MG
Sophoricoside is an isoflavone glycoside isolated from *Sophora japonica*. It has anti-inflammatory, anti-cancer, and immunosuppressive effects.
- Anti-inflammatory effects
- Anti-cancer effects
- Immunosuppressive effects
- Isolated from *Sophora japonica*
Medchemexpress LLC Sophoricoside | 152-95-4 | 432.38 | 1 ML
Sophoricoside is an isoflavone glycoside isolated from *Sophora japonica* with anti-inflammatory, anti-cancer, and immunosuppressive effects. It significantly inhibits histamine release and reduces the levels of TNF-α, IL-8, and IL-6. It also reduces scratching behaviors in vivo and aids in the recovery of atopic dermatitis.
- Inhibits PMACI-induced histamine release
- Reduces TNF-α, IL-8, and IL-6 levels
- Inhibits Rel/p65 nuclear levels
- Reduces caspase-1 activity
- Decreases scratching behaviors in vivo
- Aids in recovery from atopic dermatitis