Isoflavonoids
Medchemexpress LLC Formononetin | 485-72-3 | 98.79% | 268.26 | 5 MG
Formononetin (Standard) is the analytical standard of Formononetin, intended for research and analytical applications. It is a potent FGFR2 inhibitor that potently inhibits angiogenesis and tumor growth. The compound is of analytical standard grade, used as a reference standard in qualitative, quantitative, and methodological research experiments.
- Analytical standard of Formononetin
- Potent FGFR2 inhibitor with an IC50 of ~4.31 μM
- Potently inhibits angiogenesis and tumor growth
- Commonly used in qualitative, quantitative and methodological research experiments in HPLC, GC and MS
Selleck Chemical LLC Genistein 100mg 446-72-0
Genistein, a phytoestrogen found in soy products, is a highly specific inhibitor of protein tyrosine kinase (PTK) which blocks the mitogenic effect mediated by EGF on NIH-3T3 cells with IC50 of 12?M or by insulin with IC50 of 19 ?M. *For Research & Development use only. Product is not intended for drug, household, or human consumption.
Medchemexpress LLC Genistein (Standard) | 446-72-0 | MFCD00016952 | 98.7% | C₁₅H₁₀O₅ | 25 MG
Genistein (Standard) is the analytical standard of Genistein, a soy isoflavone. Intended for research and analytical applications, it acts as a chemotherapeutic agent by inhibiting multiple tyrosine kinases (e.g., EGFR), altering apoptosis, cell cycle, angiogenesis, and inhibiting metastasis. Commonly used in HPLC, GC, and MS experiments, it is a light yellow to yellow solid, with a molecular weight of 270.24. Classified as a flavonoid and phenol, its sources include plants and human gut microbiota metabolites.
- Analytical standard for research and analytical applications
- Inhibits multiple tyrosine kinases; acts as chemotherapeutic agent
- Modulates apoptosis, cell cycle, angiogenesis; inhibits metastasis
- Used in HPLC, GC, and MS experiments
- Molecular weight: 270.24
- Appearance: Light yellow to yellow solid
- Classified as flavonoid and phenol
- Derived from plants and human gut microbiota metabolites
Medchemexpress LLC 5-Methyl-7-methoxyisoflavone | 82517-12-2 | 266.29 | 25 MG
5-Methyl-7-methoxyisoflavone is an orally active antioxidant with remyelinating activity. It inhibits the enzyme aromatase, interfering with the normal metabolic pathways of testosterone. It is a non-steroidal anabolic isoflavone used as an anabolic agent, showing better potency in increasing muscle mass and endurance. This compound can also be used for fat loss, maintaining low cholesterol levels, and strengthening bones. Additionally, 5-Methyl-7-methoxyisoflavone acts as an inhibitor for NF-κB.
- Orally active antioxidant with remyelinating activity.
- Inhibits aromatase enzyme.
- Non-steroidal anabolic isoflavone, acts as an anabolic agent.
- Increases muscle mass and endurance.
- Aids in fat loss.
- Helps maintain low cholesterol levels.
- Strengthens bones.
- Inhibitor for NF-κB.
- Inhibits the clonogenicity of HCT116 colon cancer cells in vitro.
Medchemexpress LLC Inactive ASO (in vivo) sodium | CCTATAGGACTATCCAGGAA | 5 MG
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide (ASO), typically 20-30 bases long, designed to interfere with or regulate gene expression. This specific ASO serves as a negative control for Tofersen, as it is not targeted in the rodent genome.
- Oligonucleotide molecules
- Interferes with or regulates gene expression
- Not targeted in the rodent genome
- Serves as a negative control for Tofersen
- Features thiophosphate skeleton modification
- Includes MOE modification
- Contains 5' methylcytosine
Medchemexpress LLC Inactive ASO (in vivo) sodium | CCTATAGGACTATCCAGGAA | 1 MG
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide (ASO) used to interfere with or regulate gene expression. This ASO is not targeted within the rodent genome and serves as a negative control for Tofersen. It features thiophosphate skeleton modification and MOE modification, and its cytosine is 5' methylcytosine.
- Inactive Antisense Oligonucleotide (ASO)
- Negative control for Tofersen
- Thiophosphate skeleton modification
- MOE modification
- 5' methylcytosine as cytosine
- White to off-white solid appearance
- Purity of 92.18%
Medchemexpress LLC 5-Methyl-7-methoxyisoflavone | 82517-12-2 | 266.29 | 50 MG
5-Methyl-7-methoxyisoflavone is an orally active anti-oxidant with remyelinating activity. It inhibits the enzyme aromatase and acts as a non-steroidal anabolic isoflavone, demonstrating better potency in increasing muscle mass and endurance than Ipriflavone. It is also an inhibitor for NF-κB and can be used for fat loss, maintaining low cholesterol levels, and strengthening bones.
- Orally active anti-oxidant
- Inhibits aromatase enzyme
- Non-steroidal anabolic isoflavone
- Increases muscle mass and endurance
- Supports fat loss
- Helps maintain low cholesterol levels
- Strengthens bones
- Inhibits NF-κB
Medchemexpress LLC Daidzein-4',7-diglucoside | 53681-67-7 | 99.7% | 578.52 | 5 MG
Daidzein-4',7-diglucoside is a natural product that can be isolated from *Radix puerariae*. It is intended for research use only.
- Isolated from *Radix puerariae*
- Appears as a solid
- Color is white to off-white
- Classified as a flavonoid and isoflavone
- Initial source is plants, Leguminosae, *Piptanthus nepalensis (Hook.) D. Don*
- Part of compound screening libraries
- Cited in one publication
Cayman Chemical Genistein Fatty Acids and Deri
An isoflavonoid phytoestrogen with kinase inhibitory, anticancer, pro-cancer, hepatoprotective, and antiviral properties; inhibits EGFR, pp50v-Src, and pp110gag-fes (IC50s = 6, 7-8, and 6.5 UG/ml, respectively); reduces tumor invasion and angiogenesis in a Bel 7402 mouse subrenal capsule xenograft model at 50 mg/kg per day; increases the incidence of uterine adenocarcinoma in a mouse model of cancer induced by DES at 50 mg/kg per day administered on postnatal days 1-5; reduces lipid accumulation and inflammation in the liver of OVX and non-OVX female rats in a model of high-fat high-fructose diet-induced model of NASH at 16 mg/kg per day; inhibits HIV-1 DNA synthesis in resting CD4+ T cells at 10 µM
![Alkali Scientific Genistein [4',5,7 Trihydroxyisoflavone], 25 Mg](https://assets.fishersci.com/TFS-Assets/CCG/product-images/5000661372.jpg-250.jpg)
Alkali Scientific Genistein [4',5,7 Trihydroxyisoflavone], 25 Mg
Genistein (4',5,7 Trihydroxyisoflavone), provided in a 25mg quantity, is an isoflavone commonly used as a kinase inhibitor in molecular biology and pharmacological research. It has a wide range of biological activities, particularly in inhibiting tyrosine kinases involved in signal transduction pathways. Genistein is used in cancer research, where it helps block signaling pathways that contribute to tumor growth and metastasis. It also has potential therapeutic applications in conditions such as osteoporosis, cardiovascular diseases, and inflammation. In laboratory studies, Genistein is used to explore the effects of kinase inhibition on cellular processes, gene expression, and cell survival.
Selleck Chemical LLC Daidzein S1849-50mg
Daidzein is a natural isoflavone phytoestrogen found in Leguminosae used as a component of foods and dietary supplements Daidzein is a soy isoflavone which acts as a PPAR activator
Cambridge Isotope Laboratories Daidzein (unlabeled) 60 ug/mL in acetonitrile 1 2 mL
Daidzein (unlabeled) 60 ug/mL in acetonitrile 1 2 mL
Medchemexpress LLC Sodium formononetin-3'-sulfonate | 949021-68-5 | 99.8% | 10 MM * 1 ML
Sodium formononetin-3'-sulfonate (Sul-F) is a water-soluble derivative of formononetin. Research indicates that Sul-F significantly prevents the elevation of ST-segment levels and decreases several serum markers associated with myocardial injury. It is also noted for its favorable water solubility, lipid-lowering, and liver-protection activities, making it suitable for various research applications.
- Prevents elevation of ST-segment level.
- Decreases creatine kinase-MB, lactate dehydrogenase, alanine aminotransferase, and cardiac troponin T levels.
- Reduces myocardium necrosis scores.
- Elevates expression of endogenous antioxidant defense enzymes.
- Degrades lipid peroxidation products.
- Improves energy metabolism of cardiac mitochondria.
- Attenuates cardiocyte apoptosis.
- Exhibits good lipid-lowering and liver-protection activities.
Medchemexpress LLC Genistein 7-β-d-glucuronide | 38482-81-4 | MFCD24849233 | 98.8% | 446.36 | C21H18O11 | 5 MG
Genistein 7-β-d-glucuronide is a natural isoflavone glucuronide reported to inhibit tubulogenesis and endothelial migration. It is provided as a research reagent and is characterized by formula C21H18O11 and molecular weight 446.36.
- High purity (98.8%) suitable for analytical and biological studies.
- Stable storage recommendations included for long-term and short-term preservation.
- Available in small milligram quantities for laboratory experiments.
- Suitable for studies of endothelial cell function and tubulogenesis.
- Provided with supplier characterization data for research reproducibility.