Trays
- (1)
- (3)
- (2)
- (19)
- (6)
- (4)
- (1)
- (24)
- (1)
- (8)
- (9)
- (5)
- (12)
- (9)
- (56)
- (7)
- (15)
- (1)
- (2)
- (1)
- (10)
- (2)
- (11)
- (3)
- (6)
- (7)
- (4)
- (2)
- (1)
- (11)
- (1)
- (37)
- (4)
- (8)
- (3)
- (9)
- (1)
- (5)
- (4)
- (3)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (7)
- (4)
- (17)
- (6)
- (7)
- (1)
- (1)
- (1)
- (2)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (2)
- (1)
- (2)
- (1)
- (3)
- (1)
- (2)
- (2)
- (2)
- (1)
- (1)
- (2)
- (13)
- (1)
- (1)
- (1)
- (2)
- (2)
- (3)
- (1)
- (2)
- (2)
- (1)
- (2)
- (1)
- (1)
- (2)
- (1)
- (1)
- (1)
- (4)
- (1)
- (1)
- (2)
- (2)
- (1)
- (1)
- (2)
- (1)
- (1)
- (2)
- (1)
- (2)
- (1)
- (1)
- (10)
- (1)
- (1)
- (1)
- (4)
- (1)
- (1)
- (1)
- (2)
- (3)
- (1)
- (2)
- (1)
- (3)
- (1)
- (4)
- (1)
- (1)
- (1)
- (2)
- (1)
- (2)
- (3)
- (2)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (3)
- (1)
- (2)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (1)
- (2)
- (2)
- (1)
- (2)
- (1)
- (4)
- (1)
- (2)
- (1)
- (2)
- (1)
- (3)
- (1)
- (3)
- (2)
- (1)
- (1)
- (2)
- (2)
- (3)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (4)
- (1)
- (2)
- (1)
- (2)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (3)
- (5)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (2)
- (1)
- (1)
- (1)
- (2)
- (1)
- (1)
- (2)
- (1)
- (1)
- (4)
- (2)
- (1)
- (7)
- (3)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (5)
- (1)
- (1)
- (1)
- (1)
- (1)
- (7)
- (1)
- (2)
- (2)
- (3)
- (1)
- (1)
- (1)
- (2)
- (6)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (9)
- (7)
- (4)
- (1)
- (1)
- (1)
- (2)
- (1)
- (2)
- (1)
- (2)
- (8)
- (4)
- (2)
- (2)
- (1)
- (1)
- (1)
- (1)
- (2)
- (1)
- (2)
- (2)
- (7)
- (2)
- (1)
- (1)
- (2)
- (4)
- (6)
- (1)
- (1)
- (1)
- (4)
- (2)
- (1)
- (1)
- (3)
- (2)
- (1)
- (3)
- (2)
- (1)
- (3)
- (1)
- (4)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (2)
- (1)
- (1)
- (1)
- (1)
- (2)
- (1)
- (5)
- (1)
- (1)
- (9)
- (1)
- (1)
- (1)
- (1)
- (1)
- (1)
- (2)
- (2)
- (1)
- (1)
Filtered Search Results
Medchemexpress LLC Tilavonemab Abbv-8E12 | HY-P99163-5MG
Small and Specialty Supplier Partner
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
Tilavonemab Abbv-8E12
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Abcam ABCAM LTD
NC3973291 EB3
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
DIMA BIOTECHNOLOGY LLC PME101277
NC3343600 PME101277
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
KAYAKU ADVANCED MATERIALS INC LOR10C
NC2755130 LOR10C
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Gene Tools LLC CCTCTTACCTCAGTTACAATTTATA
Small and Specialty Supplier Partner
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
NC3823264 CCTCTTACCTCAGTTACAATTTATA
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Santa Cruz Biotechnology ASGPR2/Asialoglycoprotein Receptor 2/ASGR2 Antibody (B-4) 200 µg/ml
Small and Specialty Supplier Partner
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
ASGPR2/Asialoglycoprotein Receptor 2/ASGR2 Antibody (B-4) is a mouse monoclonal IgG1 κ, cited in 1 publications, provided at 200 µg/mlraised against amino acids 81-135 mapping within an internal region of ASGPR2 of human originASGPR2/Asialoglycoprotein Receptor 2/ASGR2 Antibody (B-4) is recommended for detection of ASGPR2 of human origin by WB, IP, IF, IHC(P) and ELISA
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Sklar Instruments Instrument Tray, Sklar, Solid, Stainless Steel. The overall size of this tray is 12-3/4 inches x 10-1/2 inches x 4 inches. EA/1.
Instrument Tray, Sklar, Solid, Stainless Steel. Sklar Instrument Trays are used for sterilizing, storing and transporting instruments for surgery. Available in a variety of sizes, they feature a seamless design to prevent bacterial growth. Dome or flat lids are also available. The overall size of this tray is 12-3/4 inches x 10-1/2 inches x 4 inches.
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Medchemexpress LLC PXL770
Small and Specialty Supplier Partner
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
PXL770 10 mM * 1 mL in DMSO
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Grainger Hook and Loop 3 In PK100
The Grainger website offers a wide selection of hook and loop fasteners. These fasteners, commonly known by the Velcro brand name, consist of two components: hooks and loops. The hooks are on one side and the loops are on the other. When pressed together, the hooks catch in the loops and hold firmly. However, the two sides can be pulled apart easily for repeated fastening. These fasteners are available in various strengths, sizes, shapes, and colors. They have many uses including clothing closures, crafts, wire management, and more. Grainger's selection includes Velcro brand as well as off-brand hook and loop fasteners.
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Cole-Parmer POLY UTILITY TRAY 12 X 16 X 8
POLY UTILITY TRAY 12 X 16 X 8
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Selleck Chemical LLC RMC5127
NC3847317 RMC5127
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Research Products International Corp Open Flat Area Tray, 14 x 17 Inches
Small and Specialty Supplier Partner
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
These white polystyrene plastic trays measure 36 x 44.5 x 5.7cm (14 x 17 1/2 x 2 1/4 Inch) and fit standard lab bench drawers. Practical and functional solution for organizing the stuff of daily lab life.
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
GRAINGER INC VALVE 3/4 STEM-UP TO CLOSE 5.5
502761070 VALVE 3/4 STEM-UP TO CLOSE 5.5
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Research Products International Corp Slide Tray for Immuno-Staining with Clear Cover
Small and Specialty Supplier Partner
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
Small and/or specialty supplier based on Federal laws and SBA requirements.
Learn More
Ideal for immunostaining and other applications that requires a humid chambers for processing. Allows safe and convenient slide processing using only one hand. The black tray base is molded from durable ABS plastic that provides excellent chemical resistance. Holds up to twenty slides on four plastic rails. A thin polymer strip on each rail holds slides level. Deep wells between rails are designed to hold water securely without splashing for procedures requiring humidity. A built-in drain plug allows a convenient emptying of contents. The clear cover allows for visual examination. Made of PETG with a temperature range of -20 °C to +60 °C.
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More
Grainger Hook and Loop 1 In PK100
The VELCRO Brand Hook and Loop Fastener Roll is a 2" wide x 15' long roll of black nylon hook and loop fastener. It features a hook side that adheres to the loop side for a secure, adjustable closure. This industrial strength fastener can withstand repeated use and washing. It bonds on contact and separates cleanly without damage. The hook and loop closure is versatile for a wide variety of securing, attaching, and fastening applications. This VELCRO brand fastener roll is made in the USA.
Non-distribution item offered as a customer accommodation; additional freight charges may apply.
Learn More