Electrical and Lighting Maintenance
MSC Leviton 4570-C 250 VAC 15A NEMA L6-15P Industrial Twist Lock Plug 2 Poles, 3 Wires, 1 Phase, Self-Grounding, 0.245 to 0.7" Cord Diam, Black/White
Leviton 4570-C 250 VAC 15A NEMA L6-15P Industrial Twist Lock Plug 2 Poles, 3 Wires, 1 Phase, Self-Grounding, 0.245 to 0.7" Cord Diam, Black/White
MSC Leviton 2411 125/250 VAC 20A NEMA L14-20P Industrial Twist Lock Plug 3 Poles, 4 Wires, 1 Phase, Self-Grounding, 0.595 to 0.895" Cord Diam, Black/White
Leviton 2411 125/250 VAC 20A NEMA L14-20P Industrial Twist Lock Plug 3 Poles, 4 Wires, 1 Phase, Self-Grounding, 0.595 to 0.895" Cord Diam, Black/White
MSC Ferraz Shawmut TRS75R 600 VAC/VDC, 75 Amp, Time Delay General Purpose Fuse Clip Mount, 7-7/8" Overall Length, 100 at DC, 200 at AC kA Rating, 1-5/16" Diam
Ferraz Shawmut TRS75R 600 VAC/VDC, 75 Amp, Time Delay General Purpose Fuse Clip Mount, 7-7/8" Overall Length, 100 at DC, 200 at AC kA Rating, 1-5/16" Diam
MSC Leviton 2511 120/208 VAC 20A NEMA L21-20P Industrial Twist Lock Plug 4 Poles, 5 Wires, 3 Phase, Self-Grounding, 0.595 to 0.895" Cord Diam, Black/White
Leviton 2511 120/208 VAC 20A NEMA L21-20P Industrial Twist Lock Plug 4 Poles, 5 Wires, 3 Phase, Self-Grounding, 0.595 to 0.895" Cord Diam, Black/White
MSC Thomas & Betts 2RA18 22 to 18 AWG Compatible, Nylon Fully Insulated, Crimp-On Butt Splice Terminal 2 Wire Entries, Copper Contacts, Tin Contact Plating, 1.19" Overall Length, Red
Thomas & Betts 2RA18 22 to 18 AWG Compatible, Nylon Fully Insulated, Crimp-On Butt Splice Terminal 2 Wire Entries, Copper Contacts, Tin Contact Plating, 1.19" Overall Length, Red
New England Biolabs, Inc. Control LAMP Primer Mix (rActin) - 50 rxns
The Control LAMP Primer Mix (rActin) targets actin RNA at an exon-exon junction. It is a LAMP primer set (F3 B3 FIP BIP LF LB) that amplifies rActin to ensure the absence of inhibition from human nucleic acid templates in a LAMP reaction. Control LAMP Primer Sequences rActin (5 3) rActin Primer Set Sequence ACTB-F3 AGTACCCCATCGAGCACG ACTB-B3 AGCCTGGATAGCAACGTACA ACTB-FIP GAGCCACACGCAGCTCATTGTATCACCAACTGGGACGACA ACTB-BIP CTGAACCCCAAGGCCAACCGGCTGGGGTGTTGAAGGTC ACTB-LF TGTGGTGCCAGATTTTCTCCA ACTB-LB CGAGAAGATGACCCAGATCATGT
MSC Southwire 11589901 THHN/THWN, 12 AWG, 20 Amp, 500' Long, Solid Core, 1 Strand Building Wire Red, Thermoplastic Insulation
Southwire 11589901 THHN/THWN, 12 AWG, 20 Amp, 500' Long, Solid Core, 1 Strand Building Wire Red, Thermoplastic Insulation
MSC Thomas & Betts 10RC-14F 1/4" Stud, 12 to 10 AWG Compatible, Partially Insulated, Crimp Connection, Standard Fork Terminal 1/2" Fork Width, Vinyl Insulation, Yellow, 1.15" Overall Length, 600 Volts, Copper Contacts
Thomas & Betts 10RC-14F 1/4" Stud, 12 to 10 AWG Compatible, Partially Insulated, Crimp Connection, Standard Fork Terminal 1/2" Fork Width, Vinyl Insulation, Yellow, 1.15" Overall Length, 600 Volts, Copper Contacts
MSC Southwire 11583201 THHN/THWN, 14 AWG, 15 Amp, 500' Long, Solid Core, 1 Strand Building Wire Green, Thermoplastic Insulation
Southwire 11583201 THHN/THWN, 14 AWG, 15 Amp, 500' Long, Solid Core, 1 Strand Building Wire Green, Thermoplastic Insulation
MSC 3M 7010397277 16-14 AWG Partially Insulated Crimp Connection Circular Ring Terminal 5/16" Stud, Copper Contact
3M 7010397277 16-14 AWG Partially Insulated Crimp Connection Circular Ring Terminal 5/16" Stud, Copper Contact
MSC Southwire 411030501 14 AWG, 41 Strand, White Machine Tool Wire PVC, Acid, Moisture and Oil Resistant, 500 Ft. Long
Southwire 411030501 14 AWG, 41 Strand, White Machine Tool Wire PVC, Acid, Moisture and Oil Resistant, 500 Ft. Long
MSC Thomas & Betts RB14-250A 16 to 14 AWG Fully Insulated Female Wire Disconnect 1/4" Tab, Blue, CSA Certified, RoHS Compliant, UL 94 V-2, UL File E66716, UL Listed
Thomas & Betts RB14-250A 16 to 14 AWG Fully Insulated Female Wire Disconnect 1/4" Tab, Blue, CSA Certified, RoHS Compliant, UL 94 V-2, UL File E66716, UL Listed
MSC Thomas & Betts 5252 1/2" Trade Liquidtight Conduit Connector Malleable Iron, Noninsulated, Angled Connector, Threaded Connection
Thomas & Betts 5252 1/2" Trade Liquidtight Conduit Connector Malleable Iron, Noninsulated, Angled Connector, Threaded Connection
MSC Leviton 9650-P 250 VAC, 50 Amp, 6-50P NEMA, Angled, Self Grounding, Industrial Grade Plug 2 Pole, 3 Wire, 1 Phase, Nylon, Black
Leviton 9650-P 250 VAC, 50 Amp, 6-50P NEMA, Angled, Self Grounding, Industrial Grade Plug 2 Pole, 3 Wire, 1 Phase, Nylon, Black
MSC 3M 7010397428 #10 Stud, 22 to 18 AWG Compatible, Partially Insulated, Crimp Connection, Standard Fork Terminal Vinyl Insulation, Red
3M 7010397428 #10 Stud, 22 to 18 AWG Compatible, Partially Insulated, Crimp Connection, Standard Fork Terminal Vinyl Insulation, Red