Electrical and Lighting Maintenance
THORLABS INC SMA Coaxial Cable, SMA Male to BNC Male, 12" (304 mm)
SMA Coaxial Cable, SMA Male to BNC Male, 12" (304 mm)
Med Vet International Unisex Lab Coat, Staff Length, Poplin, 3 Pockets, White, Size 40, Each
Staff Length Lab Coat: In an easy care, 80% polyester/20% cotton poplin fabric that's designed to resist wrinkles. Button-front styling with two lower pockets, one chest pocket (with pencil slot) and side vent openings for easy access to pants pockets. 39" length. White, Size 40.
New England Biolabs, Inc. Control LAMP Primer Mix (rActin) - 50 rxns
The Control LAMP Primer Mix (rActin) targets actin RNA at an exon-exon junction. It is a LAMP primer set (F3 B3 FIP BIP LF LB) that amplifies rActin to ensure the absence of inhibition from human nucleic acid templates in a LAMP reaction. Control LAMP Primer Sequences rActin (5 3) rActin Primer Set Sequence ACTB-F3 AGTACCCCATCGAGCACG ACTB-B3 AGCCTGGATAGCAACGTACA ACTB-FIP GAGCCACACGCAGCTCATTGTATCACCAACTGGGACGACA ACTB-BIP CTGAACCCCAAGGCCAACCGGCTGGGGTGTTGAAGGTC ACTB-LF TGTGGTGCCAGATTTTCTCCA ACTB-LB CGAGAAGATGACCCAGATCATGT
MSC Grounding Cable with Clamps
19 AWG, 10 Ft., Hand Clamp, Grounding Cable with Clamps, Orange, Includes 2 Hand Clamps.
Enterprise Technology Solutions Boost Charge Usb-C Cable
BOOST CHARGE Braided USB-C to USB-C Cable 3 3 ft White
THORLABS INC RG-58 BNC Coaxial Cable, BNC Male to BNC Male, 36" (914 mm)
RG-58 BNC Coaxial Cable, BNC Male to BNC Male, 36" (914 mm)
VWR International HALOGEN LAMP F/ V-1200,UV-1600
Halogen lamp for V-1200, UV-1600PC, UV-3100PC, V-3000PC
Electronix Express RSR HELPING HAND W/MAGNIFIER
This item has a minimum qty of 4 per supplier requirements.
DSC Optical Services Inc DDL HALOGEN BULB 20V 150W
This item has a minimum order quantity of 3 per supplier requirements. HALOGEN LAMP 6 VOLTS 30 WATTS