Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.

Search Within Results

121 – 135 of 1,323 results

121

BD Human Th1/Th17 Phenotyping Kit

Simultaneously view Th1 and Th17 cells in mouse model systems

Pricing & Availability

122

MilliporeSigma™ Upstate ChIPAb+ Trimethyl-Histone H4 (Lys20) - ChIP Validated Antibody and Primer Set

Trimethyl histone H4 (Lys20) antibody against synthetic peptide corresponding to amino acids 18-22 of histone H4 trimethylated on lysine 20

Pricing & Availability

123

Mouse TNF ELISPOT Pair, BD

Convenient set of unlabelled anti-TNF capture antibody and a biotinylated anti-TNF detection antibody

Pricing & Availability

124

MilliporeSigma™ Upstate™ Estrogen Receptor αα, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C for one year from date of shipment
Host Species	Mouse
Applications	ChIP Assay,Western Blot
Form	Ascites
Gene Accession No.	P03372
Includes	This ChIPAb+ Estrogen Receptor α -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Estrogen Receptor αα
Regulatory Status	RUO
Gene Symbols	ESR1, Era, ER-alpha, ESR, ER, NR3A1, ESRA, DKFZp686N23123
Gene ID (Entrez)	NM_000125.2
Formulation	Anti-ERα (mouse ascites). 1 vial containing 100mL ascites. The ERα antibody is made against aa120-170 of bovine estrogen a. It can recognize human and mouse ERα. ChIP primers TFF1 (pS2). 1 vial containing 75mL of 5μM of each control primer specific for human TFF1 (pS2) promoter. FOR: CCG GCC ATC TCT CAC TAT GAA; REV: CCT TCC CGC CAG GGT AAA TAC
Immunogen	The ERα antibody is made against aa 120-170 of bovine estrogen α.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Estrogen Receptor α

125

Anti-Human Foxp3 Staining Set PE, eBioscience™

Antibody Staining Kit

Pricing & Availability

126

Anti-Human Foxp3 Staining Set APC, eBioscience™

Antibody Staining Kit

Pricing & Availability

127

BD Imag™ Biotin Mouse NK Cell Enrichment Set - DM

For negative selection of Natural Killer (NK) cells from mouse spleen or lymph node

Pricing & Availability

128

MilliporeSigma™ Upstate™ CHD1, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	O14646
Includes	This ChIPAb+ Validated Antibody and Primer Set conveniently includes the antibody, matched IgG negative control antibody and set control PCR primers that detect a known positive locus.
Antigen	CHD1
Regulatory Status	RUO
Gene Symbols	Chd1, Chd-1
Gene ID (Entrez)	NP_001261
Formulation	Anti-CHD1 (Rabbit Polyclonal). One vial containing 7.0μg purified rabbit polyclonal in 50μL buffer of Tris-buffered Saline containing 0.1% BSA and 0.09% Sodium Azide, before the addition of 30% glycerol (0.14mg/mL final). Normal Rabbit IgG. One vial containing 125μg of purified Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers, PSMC6. One vial containing 75μL of 5μM of each primer specific for human proteasome 26S subunit 6 (chr14:53174161+53174274 , hg19 build). Primer location selection based on ENCODE browser data at UCSC, see also reference 1. FOR: TCC GGC CCT GAG CTT GT; REV: CCT CCT CTA CTT CTT TTT CAT TTT CAC
Immunogen	Recombinant protein corresponding to human CHD1 (a.a. 1660-1710).
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes CHD1 in regions between a.a. 1660 to 1710.

129

BD Biotin Mouse CD4 T Lymphocyte Enrichment Set - DM

For negative selection of CD4 T lymphocytes from mouse spleen or lymph node

Pricing & Availability

130

MilliporeSigma™ Upstate™ Acetyl-Histone H3, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C from date of receipt
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	P68431
Includes	Acetyl-Histone H3 ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3Ac.
Antigen	Acetyl-Histone H3
Regulatory Status	RUO
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Acetyl-Histone H3 (rabbit polyclonal IgG). One vial containing 125μg of protein A purified antibody in 125μL of storage buffer containing 0.1M Tris-glycine, pH 7.4, 0.15M NaCl, 0.05% sodium azide. Normal Rabbit IgG. One vial containing 125μg of normal rabbit IgG in 125μL volume. Control Primers. One vial containing 75μL of 5μM of each primer specific for for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	The acetyl-histone H3 antibody is made against a peptide corresponding to amino acids 1-20 of Tetrahymena histone H3 ARTKQTAR[K]STGG[K]APRKQL(C) where [K] is acetylated)
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes acetyl-histone H3

131

Avian Influenza A H4N6 Hemagglutinin Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™

Antibody pair for Solid phase sandwich ELISA

Pricing & Availability

132

MilliporeSigma™ Upstate™ Acetyl-Histone H3 (Lys4), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Gene Accession No.	Q16695
Includes	This ChIPAb+ Acetyl-Histone H3 (Lys4) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Acetyl-Histone H3 (Lys4)
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g , H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Acetyl-Histone H3 (Lys4) (rabbit polyclonal). One vial containing 100μL of immunoaffinity purified rabbit polyclonal in storage buffer containing 0.05% sodium azide with 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	KLH-conjugated,synthetic peptide containing the sequence …RTAcKQ… in which AcK corresponds to acetyl lysine 4 of human histone H3.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Histone H3 acetylated on Lys4.

133

MilliporeSigma™ Upstate™ LEF1α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C for one year from date of shipment
Host Species	Mouse
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	Q9UJU2
Isotype	IgG1
Includes	This ChIPAb+ LEF1 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	LEF1α
Regulatory Status	RUO
Gene Symbols	LEF1, DKFZp586H0919, TCF1ALPHA, LEF-1, TCF1-alpha
Gene ID (Entrez)	NM_016269.2
Formulation	Anti-LEF1 (mouse IgG1). 1 vial containing 100mg of thiophilic and size exclusion chromatography purified mouse IgG1 in 100mL of phosphate buffered saline with sodium azide. The antibody is made against amino acid residues 1-85 of human LEF1 and can recognize human and mouse LEF1. It does not cross-react with TCF-3 or TCF-4. Normal Mouse IgG. One vial containing 125μg of normal mouse IgG in 125μL volume. ChIP primers c-myc. One vial containing 75mL of 5μM of each control primer specific for human c-myc promoter. FOR: CCC AAA AAA AGG CAC GGA A; REV: TAT TGG AAA TGC GGT CAT GC
Immunogen	The antibody is made against amino acid residues 1-85 of human LEF1.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes LEF1 (lymphoid enhancer-binding factor 1).

134

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form	Purified
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Trimethyl-Histone H3 (Lys36)α
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.

135

BD Mouse T Lymphocyte Subset Antibody Cocktail

Designed to identify major subsets of T lymphocytes by direct immunofluorescent staining with flow cytometric analysis

Pricing & Availability
Specifications

Regulatory Status	RUO
Content And Storage	Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze.
Purification Method	Affinity Purified
Host Species	Mouse

Antibody Panels and Kits

Filtered Search Results

Narrow Results

Avian Influenza A H4N6 Hemagglutinin Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™ Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Avian Influenza A H4N6 Hemagglutinin Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™