Electrical and Lighting Maintenance
Andwin Scientific 50W 12V OSRAM HALOGEN BULB
Made with glass, the 5.4 x 4.8 x 3 in Osram halogen bulb provides a brilliant accent light. This bulb is approved for use in open
New England Biolabs, Inc. Control LAMP Primer Mix (rActin) - 50 rxns
The Control LAMP Primer Mix (rActin) targets actin RNA at an exon-exon junction. It is a LAMP primer set (F3 B3 FIP BIP LF LB) that amplifies rActin to ensure the absence of inhibition from human nucleic acid templates in a LAMP reaction. Control LAMP Primer Sequences rActin (5 3) rActin Primer Set Sequence ACTB-F3 AGTACCCCATCGAGCACG ACTB-B3 AGCCTGGATAGCAACGTACA ACTB-FIP GAGCCACACGCAGCTCATTGTATCACCAACTGGGACGACA ACTB-BIP CTGAACCCCAAGGCCAACCGGCTGGGGTGTTGAAGGTC ACTB-LF TGTGGTGCCAGATTTTCTCCA ACTB-LB CGAGAAGATGACCCAGATCATGT
Bulbman Inc CF9DS/827/ECO Osram 21272
9 Watt Plug-in Style Compact Fluorescent Bulb - 2700 Kelvin - G23 Base
Moc Incorporated XENOPHOT HLX OSRAM 5/PK
Lamp; Halogen; XENOPHOT;; Low-voltage lamps without reflector; Luminous flux (lm): 3600; Diameter d(mm): 11.5; Average life 50 hr.
Bulbtronics Inc USH-102DH 100W Mercury Arc Lamp Microscopy
Lamp, Halogen, Bulbtronics; 120V, 100W; Base: No. 11/Mini candelabra; Shape: T4; Overall L: 3-1/8 in.; Contains mercury
Bulbman Inc MINI HALOGEN BULB T3 20W 12V
Osram Sylvania tungsten halogen quartz 20 watt, 12 volt standard low pressure clear finish UV-filter with transverse filament G4 bi-pin base 2000 hour lamp life
Cayman Chemical DIfluorInated H2S FluorScent
A fluorescent probe for H2S; ex/em = 365/450 nm, respectively; selectively fluoresces in the presence of H2S over Zn2+, Fe3+, S2O32-, ClO-, SO32-, H2O2, NO2-, Cys, Hcy, and GSH at 1 µM
WELCH ALLYN INC 3.5 HALOGEN LAMP BULB
This item has a minimum qty of 6 per supplier requirements. 3.5 HALOGEN LAMP BULB.
Bulbman Inc Red Ceramic Light Bulb, 25 Watt, 130 Volt
25 Watt Ceramic Red Incandescent Bulb - Med Screw Base - 130 Volt
Abcam BRL 44408 maleate, alpha2A adrenoceptor antagonist, 10MG
MW 331.37 g/mol, Purity >99%. Selective α₂A adrenoceptor antagonist (Ki values are 5.68 and 651 nM for α₂A and α₂B, respectively). Centrally active following subcutaneous administration. Demonstrates antidepressant and analgesic activity.
The product is subject to the following: Abcam Restricted Use Statement
Hach Company Ultraviolet Lamp
Lamp-Ultraviolet-Long-Wave Replacement BulbMid-size (6 Watt) high intensity hand-held and line-operated Intensity at 15 2 cm (6in ) 750 W/cm2 Filters Two 6 x 7 6 cm (2 4 x 3in ) in snap on/off frame Overall dimensions 37 5 x 8 9 x 6 7 cm (14 8 x 3 5 x 2 6in ) Weight 0 91 kg (2 lbs) UL listed Meets existing OSHA electrical standards 365 nm UV Products
