Phenylpropanoids and polyketides
Apexbio Technology LLC Daunorubicin HCl 23541-50-6 10mg
Daunorubicin HCl (CAS 23541-50-6) is a small-molecule inhibitor targeting DNA topoisomerase II It is designed to inhibit topoisomerase II thereby disrupting nucleic acid synthesis and interfering with DNA replication and transcription Daunorubicin HCl exerts its biological activity primarily through stabilization of DNA-topoisomerase II complexes In in vitro studies daunorubicin exhibits cytotoxic effects with IC50 values typically ranging from 0 1 to 1 M in common leukemia cell assays Based on these pharmacological properties daunorubicin HCl holds research potential in oncology particularly for studying acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL)
eMolecules 72559-06-9 | Medchem Express | Rifabutin | 50mg | 446268153 | HY-17025 | 847.019 | C46H62N4O11
Medchem Express | Rifabutin | 50mg | 446268153 | HY-17025 | 72559-06-9 | 847.019 | C46H62N4O11
Apexbio Technology LLC Naringin 10236-47-2 10g
Naringin (CAS 10236-47-2) is a flavanone glycoside predominantly isolated from the fruit of Citrus paradisi Macfadyen (grapefruit) It is recognized for modulating various cellular pathways including inhibition of oxidative stress and inflammation through interaction with NF- B and MAPK signaling cascades Naringin has demonstrated antioxidative anti-inflammatory and potential anti-carcinogenic properties in cellular and animal models Widely used in biomedical research it serves as a tool compound for investigating mechanisms underlying chronic diseases metabolic syndromes and the modulation of drug-metabolizing enzymes For optimal stability it should be stored in a tightly sealed container under cool dry conditions
Medchemexpress LLC Inactive ASO (in vivo) sodium | CCTATAGGACTATCCAGGAA | 5 MG
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide (ASO), typically 20-30 bases long, designed to interfere with or regulate gene expression. This specific ASO serves as a negative control for Tofersen, as it is not targeted in the rodent genome.
- Oligonucleotide molecules
- Interferes with or regulates gene expression
- Not targeted in the rodent genome
- Serves as a negative control for Tofersen
- Features thiophosphate skeleton modification
- Includes MOE modification
- Contains 5' methylcytosine
Medchemexpress LLC Apigenin 7-glucoside | 578-74-5 | MFCD00016787 | 432.38 | 50 MG
Apigenin-7-glucoside (Apigenin-7-O-β-D-glucopyranoside) exhibits significant anti-proliferative and antioxidant activity and scavenges reactive oxygen species (ROS). It is for research use only and not sold to patients. It is available as a solid, light yellow to yellow in color.
- Exhibits significant anti-proliferative and antioxidant activity
- Scavenges reactive oxygen species (ROS)
- Induces differentiation of CD34+ cells towards erythroid lineage
- Inhibits myeloid differentiation
- Available as a solid, light yellow to yellow in color
Medchemexpress LLC Cinnamic acid | 621-82-9 | MFCD00004369 | 148.16 | 1 G
Cinnamic acid has potential use in cancer intervention, exhibiting IC50s of 1-4.5 mM in glioblastoma, melanoma, prostate, and lung carcinoma cells. In addition to inhibiting tumor-cell proliferation, Cinnamic acid induces morphological changes consistent with melanocyte differentiation. Treatment with Cinnamic acid also leads to a dose-dependent loss of invasive capacity in various tumor lines.
- Endogenous metabolite
- Potential use in cancer intervention
- Exhibits dose-dependent growth inhibition in various tumor cells
- Induces morphological changes consistent with melanocyte differentiation
- Causes dose-dependent loss of invasive capacity in tumor lines
- Purity: 99.98%
- Appearance: Solid
- Color: White to off-white
- Initial source: Microorganisms
- Storage: powder at -20°C for 3 years, 4°C for 2 years; in solvent at -80°C for 2 years, -20°C for 1 year
Medchemexpress LLC Sancycline (Bonomycin; 6-demethyl-6-deoxytetracycline) | 808-26-4 | 98.0% | 414.41 | 100 MG
Sancycline (6-Demethyl-6-deoxytetracycline) acts by reversibly binding to the 30 S ribosomal subunit and inhibiting protein translation by blocking entry of aminoacyl-tRNA into the ribosome, similar to tetracycline. It is a semi-synthetic tetracycline prepared by hydrogenolysis of the chloro and benzylic hydroxy moieties of Declomycin. Sancycline has been shown to decrease 2 chloroethyl ethyl sulfide (CEES) and nitrogen mustard (NM) induced corneal injuries and inhibit Matrix metalloproteinase (MMP)-9 expression in the basement membrane zone (BMZ).
- Reversibly binds to 30 S ribosomal subunit
- Inhibits protein translation
- Decreases CEES and NM induced corneal injuries
- Inhibits MMP-9 expression
Medchemexpress LLC 3-Methylflavone-8-carboxylic acid | 3468-01-7 | 99.8% | 280.28 | 10 G
3-Methylflavone-8-carboxylic acid is a biochemical reagent that can be used as a biological material or organic compound for life science related research.
- It is a biochemical reagent.
- Can be used as a biological material for life science related research.
- Can be used as an organic compound for life science related research.
- For research use only.