Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.

Search Within Results

31 – 45 of 1,387 results

MilliporeSigma™ Upstate™ NFκB p65 (RelA)α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	Q04206
Isotype	IgG3
Includes	This ChIPAb+ NFκB p65 (RelA) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	NFκB p65 (RelA)α
Regulatory Status	RUO
Gene Symbols	RELA, NFKB, p65, p50/p65
Purification Method	Protein A purified
Gene ID (Entrez)	NP_068810.3
Formulation	Anti-NFκB p65 (RelA) (mouse monoclonal). One vial containing 100μg of protein A purified monoclonal IgG3 in a total volume of 143μL in a buffer containing 0.02M phosphate buffer, 0.25M NaCl, pH 7.6 with 0.09% sodium azide, before the addition of glycerol to 30%. Nornal Mouse IgG. One vial containing 125μg of purified mouse IgG in 125μL of storage buffer containing 0.1% sodium azide. ChIP Primers, IĸBα promoter. One vial containing 75μL of 5μM of each primer specific for human IĸBα promoter. FOR: GAC GAC CCC AAT TCA AAT CG; REV: TCA GGC TCG GGG AAT TTC C
Immunogen	Peptide corresponding to human p65 coupled to BSA.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes an epitope overlapping the nuclear location signal (NLS) of the p65 subunit of the NFkB heterodimer. Thus it selectively binds to the activated form of NFkB.

MilliporeSigma™ Upstate™ SMRTα, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Electromobility Shift Assay,Immunocytochemistry,Immunohistochemistry,Immunoprecipitation,Western Blot
Form	Ascites
Gene Accession No.	Q9Y618
Isotype	IgG2a κ
Includes	The ChIPAb+ SMRT set includes the SMRT antibody, a negative control mouse ascites and qPCR primers which amplify a 299bp region of human IκBα promoter.
Antigen	SMRTα
Regulatory Status	RUO
Gene Symbols	NCOR2, CTG26, N-CoR2, SMAP270, SMRT, SMRTE, SMRTE-tau, TNRC14, TRAC, TRAC-1, TRAC1
Purification Method	Unpurified
Gene ID (Entrez)	NP_001070729.1
Formulation	Anti-SMRT (mouse monoclonal). One vial containing 50μL of unpurified mouse monoclonal ascites with 0.05% sodium azide. Negative Ascites (mouse). One vial containing 50μL of mouse ascites with 0.05% sodium azide. ChIP Primers, IκBα promoter. One vial containing 75μL of 5μM of each primer specific for human IĸBα promoter. FOR: GAC GAC CCC AAT TCA AAT CG; REV: TCA GGC TCG GGG AAT TTC C
Immunogen	Recombinant protein corresponding to human SMRT.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes SMRT.

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form	Purified
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Trimethyl-Histone H3 (Lys36)α
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.

MilliporeSigma™ P2X7 Receptor (576-595), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Includes	50μL antibody lyophilized from PBS, 1% BSA, pH 7.4 and 40μg lyophilized control peptide (immunogen).
Antigen	P2X7 Receptor (576-595)
Regulatory Status	RUO
Content And Storage	−20°C
Host Species	Rabbit
Applications	Immunoblot,Immunoblot
Form	Purified
Formulation	50μl antibody lyophilized from PBS, 1% BSA, pH 7.4 and 40μg lyophilized control peptide (immunogen).
Immunogen	a synthetic peptide [(C)KIRKEFPKTQGQYSGFKYPY] corresponding to amino acids 576-595 of rat P2X7 receptor,conjugated to receptor protein
Classification	Polyclonal
Isotype	IgG
Primary or Secondary	Primary
Test Specificity	Recognizes the P2X7 receptor protein. Supplied with a control peptide.

R&D Systems™ Human TIMP Panel Luminex™ Performance Control

Luminex bead-based multiplex assays are designed to provide accurate, reproducible results for every target analyte.

Pricing & Availability

Novus Biologicals™ TLR Screening Antibody Pack

For Research applications

Pricing & Availability
Specifications

Antigen	TLR Screening
Content And Storage	Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
Gene Alias	Toll like receptor, Toll-like receptor, Toll-like receptor (TLR)
Conjugate	Unconjugated
Target Species	Human,Mouse
Applications	Flow Cytometry,Immunocytochemistry,Immunohistochemistry,Immunohistochemistry (Paraffin),Immunoprecipitation,Western Blot
Immunogen	Following are the different antibodies included in the TLR Sampler Kit: TLR1:25 ug:WB, Flow:H, M, R:Purified TLR2 :25 ug:WB, IHC:H, M:Purified TLR2:25 ug:Flow, IP, ICC:H, D:Purified TLR3:25 ug:WB, Flow, IP, IHC:H:Purified TLR4:25 ug:Flow, IP, CM, FA-Neut:H:Purified TLR5:25 ug:WB, Flow, IHC:H, M, R:Purified TLR7:25 ug:WB, Flow, IHC, IP, IF/ICC:H, M:Purified TLR8:25 ug:WB, Flow, IHC:H, M:Purified TLR9:25 ug:WB, Flow, IHC, IF/ICC, CM:H, M, R, RM:Purified WB:Western Blot IHC:Immunohistochemistry IP:Immunoprecipitation CM:Confocal Microscopy FA-Neut Functional Assay Neutralization IF/ICC:Immunofluorescence/Immunocytochemistry D:Dog H:Human M:Mouse Mk:Monkey R:Rat RM:Rhesus Monkey

Novus Biologicals™ Autophagy Antibody Pack

For Research applications

Pricing & Availability
Specifications

Content And Storage	Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
Target Species	Alligator,Bovine,Human,Mouse,Pig,Primate,Rat
Conjugate	Unconjugated
Applications	Flow Cytometry,Immunocytochemistry/Immunofluorescence,Immunohistochemistry,Immunohistochemistry (Paraffin),Immunoprecipitation,KnockDown,Simple Western,Western Blot
Research Discipline	Autophagy
Concentration	25ul vials of each of following: NB100-2220, NB110-87318, NB110-53818, NB110-56893 and NB110-82384.
Includes	1.NB100-2220: LC3B/MAP1LC3B Antibody 2.NB110-53818: ATG5 Antibody 3.NB110-56893: ATG9A Antibody 4.NB110-82384: ATG16L1 Antibody 5.NB110-87318: Beclin 1/ATG6 Antibody
Antigen	Autophagy
Gene Symbols	BECN1
Dilution	Western Blot, Simple Western, Flow Cytometry, Immunohistochemistry, Immunocytochemistry/Immunofluorescence, Immunoprecipitation, Immunohistochemistry-Paraffin, Knockdown Validated
Gene Alias	ATG6, ATG6 autophagy related 6 homolog, beclin 1 (coiled-coil, moesin-like BCL2 interacting protein), beclin 1 (coiled-coil, moesin-like BCL2-interacting protein), beclin 1, autophagy related, beclin1, beclin-1, Coiled-coil myosin-like BCL2-interacting protein, GT197, Protein GT197, VPS30
Gene ID (Entrez)	8678
Formulation	See individual datasheets
Immunogen	See individual datasheets
Test Specificity	Autophagy Antibodies (Beclin, LC3, ATG5, ATG9, ATG16L1)

Novus Biologicals™ ARNT/HIF-1 beta Antibody Pack

For Research applications

Pricing & Availability
Specifications

Content And Storage	Store at 4C. Do not freeze.
Target Species	Bovine,Ferret,Human,Mouse,Rat,Sheep
Host Species	Mouse
Conjugate	Unconjugated
Applications	ChIP Assay,Immunoblot,Immunocytochemistry/Immunofluorescence,Immunohistochemistry,Immunohistochemistry (Paraffin),Immunoprecipitation,Western Blot
Research Discipline	Cancer, Hypoxia
Includes	1.NB100-110: ARNT/HIF-1 beta Antibody 2.NB100-124: ARNT/HIF-1 beta Antibody (H1β234)
Antigen	ARNT/HIF-1 beta
Gene Symbols	ARNT
Dilution	Western Blot, Immunohistochemistry, Immunocytochemistry/Immunofluorescence, Immunoprecipitation, Immunohistochemistry-Paraffin, Immunoblotting, Chromatin Immunoprecipitation (ChIP)
Gene Alias	ARNT protein, aryl hydrocarbon receptor nuclear translocator, BHLHE2, HIF-1 Beta, HIF1B, HIF-1-beta, HIF1-beta, HIF1BETA, hypoxia-inducible factor 1, beta subunit, Hypoxia-inducible factor 1-beta, nuclear translocator
Gene ID (Entrez)	405
Immunogen	See individual datasheets.
Test Specificity	See individual datasheets.

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,ChIP sequencing (ChIP-seq),Dot Blot,Western Blot
Form	Purified
Gene Accession No.	Q16695
Includes	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Trimethyl-Histone H3 (Lys36)
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g , H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Gene ID (Entrez)	NP_003484
Formulation	Anti-Trimethyl Histone H3 (Lys36) (Rabbit Polyclonal). One vial containing 50μL (0.05mg/mL) purified rabbit polyclonal in buffer containing 0.1M Tris-Glycine (pH 7.4), 150mM NaCl, and 0.05% sodium azide, before the addition of 30% glycerol. Normal Rabbit IgG. One vial containing 7.5μg Rabbit IgG in 75μL storage buffer containing 0.05% sodium azide. ChIP Primers, GAPDH coding D2. One vial containing 75μL of 5μM of each primer specific for human GAPDH coding region (chr12:6647453+6647539 hg19 build). FOR: 5’ GCC ATG TAG ACC CCT TGA AGA G 3’; REV: 5’ ACT GGT TGA GCA CAG GGT ACT TTA T 3’
Immunogen	Linear peptide corresponding to human Histone H3 trimethylated at Lys36 with peptide sequence APATGGV(K)KPHRYRPGC
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.

MilliporeSigma™ Upstate™ Monomethyl-Histone H3 (Lys36), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Immunoprecipitation,Western Blot
Gene Accession No.	Q16695
Includes	The ChIPAb+ Monomethyl-Histone H3 (Lys36) set includes the monomethyl-Histone H3 (Lys36) antibody, a Normal Rabbit IgG and control primers which amplify a 213bp region of the human GAPDH coding region.
Antigen	Monomethyl-Histone H3 (Lys36)
Regulatory Status	RUO
Gene Symbols	HIST3H3, H3FT, H3/t, H3t, H3/g, H3.4, H3T
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Monomethyl-Histone H3 (Lys36) (Rabbit Polyclonal). One vial containing 75μL 0.35mg/mL purified rabbit polyclonal in buffer containing 0.1M Tris-Glycine (pH 7.4), 150mM NaCl, and 0.05% sodium azide, before the addition of 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers, GAPDH coding D2. One vial containing 75μL of 5μM of each primer specific for human GAPDH coding region. FOR: GCC ATG TAG ACC CCT TGA AGA G; REV: ACT GGT TGA GCA CAG GGT ACT TTA T
Immunogen	KLH-conjugated linear peptide corresponding to the N-terminus of human Histone H3 monomethylated at Lys36.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes the N-terminus of Histone H3 monomethylated at Lys36.

MilliporeSigma™ Upstate™ Acetyl-Histone H4 (Lys16), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Immunoprecipitation,Western Blot
Form	Purified
Gene Accession No.	P62805
Includes	This ChIPAb+ Acetyl-Histone H4 (Lys16) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Acetyl-Histone H4 (Lys16)
Regulatory Status	RUO
Gene Symbols	HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_778224.1
Formulation	Anti-Acetyl-Histone H4 (Lys16) (rabbit polyclonal). One vial containing 50μL of affinity purified rabbit polyclonal serum in buffer containing 0.1 M Tris-Glycine (pH 7.4) 150mM NaCl with 0.05% sodium azide. Normal Rabbit IgG. One vial containing 125μg of rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, RPL10 promoter. One vial containing 75μL of 5μM of each primer specific for the promoter region of human RPL10. FOR: ACC CGT CTT CGA CAG GAC T; REV: GGA ACG GAA GAC GAG AAC AG
Immunogen	KLH-conjugated Histone H4 corresponding to the N-terminus region at and around acetylated Lys16.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	This antibody detects histone H4 acetylated at Lys16.

MilliporeSigma™ Upstate™ Phospho-CREB (Ser133), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Electromobility Shift Assay,Immunohistochemistry,Immunoprecipitation,Western Blot
Form	Purified
Gene Accession No.	P16220
Isotype	IgG
Includes	This ChIPAb+ Phospho-CREB (Ser133) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Phospho-CREB (Ser133)
Regulatory Status	RUO
Gene Symbols	CREB1, CREB, MGC9284
Purification Method	Purified by protein A-Sepharose followed by immunoadsorbant chromatography using an unphosphorylated CREB affinity gel column
Gene ID (Entrez)	NM_134442
Formulation	Anti-phospho-CREB (Ser133) (rabbit polyclonal). One vial containing 100μg of affinity purified rabbit serum in 0.1M Tris-Glycine (pH 7.4) 0.15M NaCl, and 0.05% sodium azide, before the addition of 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers cFos CRE. One vial containing 75μL of 5μM of each primer specific for the cFos CRE. FOR: GGC CCA CGA GAC CTC TGA GAC A; REV: GCC TTG GCG CGT GTC CTA ATC T
Immunogen	KLH-conjugated synthetic peptide corresponding to the amino acids including and encompassing phosphorylated Ser133 of CREB.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes p43 phosphorylated CREB. May also recognize p30 and p38kDa proteins. The p30 & p38 proteins may be phosphorylated CREM and ATF-1 respectively, since the two proteins share significant homology to the phosphorylated CREB immunizing peptide.

MilliporeSigma™ Upstate™ ChIPAb+™ Phospho-Histone H3 (Thr3)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Western Blot
Form	Culture Supernatant
Gene Accession No.	Q16695
Includes	This ChIPAb+ Phospho-Histone H3 (Thr3) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	ChIPAb+™ Phospho-Histone H3 (Thr3)α
Regulatory Status	RUO
Gene Symbols	HIST3H3, H3FT, MGC126886, H3t, MGC126888, H3.4, H3T, H3/g, H3/t
Gene ID (Entrez)	NM_003493
Formulation	Anti-Phospho-Histone H3 (Thr3) (rabbit monoclonal). One vial containing 50μL of cultured supernantant in 0.05% sodium azide. Negative Control Supernatant. One vial containing 100μL of cultured supernatant in 0.05% sodium azide. Control Primers, human GAPDH promoter. One vial containing 75μL of 5μM of each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	Peptide containing the sequence [RT_trimKQ] in which lysine 4 is trimethylated on human histone H3
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Histone H3 phosphorylated at Threonine 3; cross-reactivity with phospho-histone H3 Thr22 detected in some applications

Exosome Detection (Simple Western) Antibody Pack, Novus Biologicals™

nan nan Antibody

Pricing & Availability

Loading Control (Simple Western) Antibody Pack, Novus Biologicals™

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Antigen	Loading Control (Simple Western)
Regulatory Status	RUO
Content And Storage	Store at 4°CC.
Gene Alias	GAPDH, Hsp60
Target Species	Human,Mouse,Rat
Host Species	Mouse
Conjugate	Unconjugated
Applications	Immunocytochemistry/Immunofluorescence,Immunohistochemistry,Simple Western,Western Blot
Product Type	Antibody Packs
Classification	Monoclonal
Research Discipline	Loading Controls

Antibody Panels and Kits

Filtered Search Results

Narrow Results

R&D Systems™ Human TIMP Panel Luminex™ Performance Control Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Novus Biologicals™ TLR Screening Antibody Pack Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Novus Biologicals™ Autophagy Antibody Pack Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Novus Biologicals™ ARNT/HIF-1 beta Antibody Pack Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Exosome Detection (Simple Western) Antibody Pack, Novus Biologicals™ Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Loading Control (Simple Western) Antibody Pack, Novus Biologicals™ Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

R&D Systems™ Human TIMP Panel Luminex™ Performance Control

Novus Biologicals™ TLR Screening Antibody Pack

Novus Biologicals™ Autophagy Antibody Pack

Novus Biologicals™ ARNT/HIF-1 beta Antibody Pack

Exosome Detection (Simple Western) Antibody Pack, Novus Biologicals™

Loading Control (Simple Western) Antibody Pack, Novus Biologicals™