Cell Culture Growth Factors and Hormones
Medchemexpress LLC Tau ASO-12 (murine) (sodium) | 00-00-0 | 97.2% | 7619.00 Da | 5 MG
Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide intended for preclinical murine research. Supplied as the sodium salt in mg quantities, it is designed for studies of Tau biology and Alzheimer's disease models.
- Tau-lowering antisense oligonucleotide for murine models.
- Sequence: 5′ GCTTTTACTGACCATGCGAG 3′.
- Formulation: sodium salt.
- Molecular weight: 7619.00 Da.
- Purity: 97.2%.
- Storage: 4°C sealed; in solvent -80°C for 6 months, -20°C for 1 month.
- Available sizes: 1 mg, 5 mg, 10 mg, 50 mg (quote for 50 mg).
Medchemexpress LLC IL-5 Rabbit HEK293 10ug | 10ug
The IL5 protein is a cytokine that plays a key role in regulating the growth and differentiation of eosinophils a type of white blood cell involved in allergic reactions and asthma Dysregulation of IL5 protein is associated with a variety of allergic and inflammatory diseases IL-5 Protein Rabbit (HEK293 His) is the recombinant Rabbit-derived IL-5 protein expressed by HEK293 with N-6 His labeled tag
Medchemexpress LLC KGF/FGF-7 Human HE 10ug
Recombinant human keratinocyte growth factor (FGF-7) expressed in HEK293 cells with a His tag, provided in a small research pack for in vitro and cell-based studies. FGF-7 is a paracrine epithelial mitogen that promotes epithelial cell proliferation and differentiation; the recombinant format offers consistent material for signaling and bioassay applications.
- Expressed in HEK293 cells for human-like post-translational modifications.
- Includes a C-terminal His tag to facilitate purification and detection.
- Mature sequence corresponds to residues 32-194 (approximately 163 amino acids).
- Approximate molecular weight suitable for signaling and bioactivity studies (≈19 kDa).
- Suitable for cell-based assays and epithelial cell signaling studies.
- Packaged in microgram-scale amounts for research use with manufacturer storage recommendations.
Abcam TCPOBOP, Androstane receptor (mCAR) agonist, 10MG
MW 402.1 Da, Purity >99%. Potent murine constitutive androstane receptor (mCAR) agonist. Pharmacologically active in vivo.
The product is subject to the following: Abcam Restricted Use Statement
Medchemexpress LLC ROR1 Rat HEK293 H 10ug | 10ug
ROR1 protein is an important member of the Tyr protein kinase family in the protein kinase superfamily and plays a key role as a tyrosine kinase in cell signaling and regulation Its classification emphasizes its importance in phosphorylation events and shares conserved features with related kinases ROR1 Protein Rat (HEK293 His) is the recombinant rat-derived ROR1 protein expressed by HEK293 with C-10 His labeled tag
Medchemexpress LLC TGF beta 1/TGFB1 LAP 10ug | 10ug
TGF beta 1 is a secreted ligand of the TGF-beta superfamily that binds to receptors and activates SMAD transcription factors Preproprotein is proteolytically processed to produce latency-associated peptide (LAP) and mature peptide TGF beta 1/TGFB1 LAP Protein Human (HEK293 N-His) is the recombinant human-derived TGF beta 1/TGFB1 Latency-associated peptide protein expressed by HEK293 with N-6 His labeled tag and C33S mutation
Medchemexpress LLC KGF/FGF-7 Human HE 50ug
Recombinant human keratinocyte growth factor (KGF/FGF-7), expressed in HEK293 cells with a C-terminal His tag, is supplied as a lyophilized 50 μg preparation for in vitro research. It promotes epithelial cell proliferation and differentiation and exhibits measurable bioactivity in multiple cell-based assays.
- Expressed in mammalian cells to support proper folding and glycosylation.
- Supplied as a lyophilized powder for improved stability and handling.
- Low endotoxin level (<1 EU/μg) suitable for sensitive assays.
- Demonstrated activity in multiple proliferation assays (ED50 in the ng/mL range).
- Reconstitution at concentrations ≥100 μg/mL in ddH2O is recommended.
- Store at -20°C; stable short-term at 4°C after reconstitution, aliquot for long-term storage.
Medchemexpress LLC HGF Human CHO 50ug
Recombinant human hepatocyte growth factor (HGF) expressed in CHO cells and supplied lyophilized for research use. The protein is >95% pure by reducing SDS-PAGE, exhibits validated biological activity in cell-based assays, and is offered in multiple microgram-scale sizes suitable for assay development and functional studies.
- High purity suitable for biochemical and cell-based assays.
- Expression in CHO cells preserves mammalian glycosylation.
- Validated biological activity (ED50 <10 ng/mL in 4MBr5 cells).
- Available in small, convenient package sizes for assay optimization.
- Lyophilized formulation for improved stability during storage and transport.
- Stable when aliquoted and stored at -20°C or -80°C for long-term use.
- Includes amino acid sequence and molecular weight information.
Medchemexpress LLC TNF-alpha/TNFSF2 Mo 50ug
Recombinant mouse TNF-alpha (156 a.a) supplied lyophilized for use in in vitro functional and biochemical studies. Expressed in E. coli, the protein is highly pure and validated for activity in cytotoxicity and signaling assays.
- Lyophilized formulation for long-term storage and easy reconstitution.
- High purity suitable for biochemical and cell-based assays.
- Low endotoxin level (<0.2 EU/μg) for sensitive applications.
- Validated biological activity (ED50 <0.1 ng/mL in L-929 cell assay).
- Multiple pack sizes available to accommodate experimental scale.