Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.

Search Within Results

136 – 150 of 1,391 results

136

BD Biotin Mouse CD4 T Lymphocyte Enrichment Set - DM

For negative selection of CD4 T lymphocytes from mouse spleen or lymph node

Pricing & Availability

137

Exosome Detection (Simple Western) Antibody Pack, Novus Biologicals™

nan nan Antibody

Pricing & Availability

138

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form	Purified
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Trimethyl-Histone H3 (Lys36)α
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.

139

MilliporeSigma™ Upstate™ Histone H3 (CT), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Immunocytochemistry,Inhibition Assays,Western Blot
Form	Serum
Gene Accession No.	Q16695
Includes	This ChIPAb+ Histone H3 (C-Term) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Histone H3 (CT)
Regulatory Status	RUO
Gene Symbols	HIST3H3, H3FT, MGC126886, H3t, MGC126888, H3T, H3/g, H3.4, H3/t
Purification Method	Unpurified
Gene ID (Entrez)	NM_002107.3
Formulation	Anti-Histone H3 (C-Term) (rabbit polyclonal). One vial containing 25μL of rabbit antiserum diluted 1:2 in storage buffer (0.02M Phosphate, 0.25M NaCl, 0.1% sodium azide) before the addition of glycerol to 30%. Normal Rabbit Serum. One vial containing 25μL of antiserum containing 0.05% sodium azide. ChIP Primers, human β-globin. One vial containing 75μL of 5μM of each primer specific for the human β-globin promoter. FOR: AGG ACA GGT ACG GCT GTC ATC; REV: TTT ATG CCC AGC CCT GGC TC
Immunogen	KLH-conjugated,synthetic peptide corresponding to the C-terminus of human Histone H3.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes C-Terminal region of Histone H3, Mr 17kDa

140

MilliporeSigma™ Upstate™ NFκB p65 (RelA)α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	Q04206
Isotype	IgG3
Includes	This ChIPAb+ NFκB p65 (RelA) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	NFκB p65 (RelA)α
Regulatory Status	RUO
Gene Symbols	RELA, NFKB, p65, p50/p65
Purification Method	Protein A purified
Gene ID (Entrez)	NP_068810.3
Formulation	Anti-NFκB p65 (RelA) (mouse monoclonal). One vial containing 100μg of protein A purified monoclonal IgG3 in a total volume of 143μL in a buffer containing 0.02M phosphate buffer, 0.25M NaCl, pH 7.6 with 0.09% sodium azide, before the addition of glycerol to 30%. Nornal Mouse IgG. One vial containing 125μg of purified mouse IgG in 125μL of storage buffer containing 0.1% sodium azide. ChIP Primers, IĸBα promoter. One vial containing 75μL of 5μM of each primer specific for human IĸBα promoter. FOR: GAC GAC CCC AAT TCA AAT CG; REV: TCA GGC TCG GGG AAT TTC C
Immunogen	Peptide corresponding to human p65 coupled to BSA.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes an epitope overlapping the nuclear location signal (NLS) of the p65 subunit of the NFkB heterodimer. Thus it selectively binds to the activated form of NFkB.

141

MilliporeSigma™ Upstate™ JMJD6, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Gene Accession No.	Q6NYC1
Includes	This ChIPAb+ JMJD6 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	JMJD6
Regulatory Status	RUO
Gene Symbols	JMJD6, PTDSR1, PTDSR, PSR
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_001074930
Formulation	Anti-JMJD6 (rabbit polyclonal). One vial containing 50μL of purified rabbit polyclonal in buffer containing 0.1M Tris-Glycine (pH 7.4), 150mM NaCl and 0.05% sodium azide before the addition of glycerol to 30%. Concentration: 0.7mg/mL. Normal Rabbit IgG. One vial containing 125μg of Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, human β-globin. One vial containing 75μL of each primer (5μM) specific for the human β-globin promoter. FOR: AGG ACA GGT ACG GCT GTC ATC; REV: TTT ATG CCC AGC CCT GGC TC
Immunogen	Linear peptide corresponding to human JMJD6.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes JMJD6.

142

Cytometric Bead Array (CBA) PE Goat anti-Rat Ig Detector, Clone: Poly1271, BD

Pricing & Availability

143

Novus Biologicals™ Pluripotent Stem Cell Transcription Factor Antibody Pack

For Research applications

Pricing & Availability
Specifications

Antigen	Pluripotent Stem Cell Transcription Factor
Content And Storage	Store at 4C. Do not freeze.
Target Species	Human,Mouse,Rat,Bovine,Chicken,Primate,Sheep
Host Species	Rabbit
Conjugate	Unconjugated
Applications	Western Blot,Flow Cytometry,Immunohistochemistry,Immunocytochemistry,Immunofluorescence,Immunoprecipitation
Classification	Polyclonal
Immunogen	NB100-58842: A synthetic peptide made to the mouse Nanog protein (within residues 1-50). [Swiss-Prot Q80Z64]. NB100-2379-A synthetic peptide made to an internal portion

144

MilliporeSigma™ Upstate™ TCF-4α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Dot Blot,Western Blot
Form	Purified
Gene Accession No.	Q9NQB0
Isotype	IgG2a
Includes	This ChIPAb+ TCF-4 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	TCF-4α
Regulatory Status	RUO
Gene Symbols	TCF4, TCF-4, TCF7L2
Purification Method	Protein G chromatography
Gene ID (Entrez)	CAB97213.1
Formulation	Anti-TCF-4 (mouse monoclonal). One vial containing 50μg of purified mouse monoclonal IgG2a in 50μL of buffer containing 0.1 M Tris-glycine, pH 7.4, 0.15 M NaCl, 0.05% sodium azide and 30% glycerol. Normal Mouse IgG. Two vials containing 25μg of purified IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, SP5 promote. One vial containing 75μL of 5μM of each primer specific for human SP5 promotor. FOR: GGG TCT CCA GGC GGC AAG; REV: AGC GAA AGC AAA TCC TTT GAA TCC
Immunogen	Amino acids 31-331 of human TCF-4.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes TCF-4

145

MilliporeSigma™ Upstate™ N-CoR, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Gene Accession No.	Q60974.
Includes	This ChIPAb+ N-CoR -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	N-CoR
Regulatory Status	RUO
Gene Symbols	Ncor1, Rxrip13
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_035438
Formulation	Anti-N-CoR (Rabbit Polyclonal). One vial containing 75μg of affinity purified polyclonal in buffer containing 0.1M Tris-glycine (pH 7.4) and 150mM NaCl with 0.05% sodium azide before the addition of 30% glycerol. Concentration: 0.7mg/mL. Normal Rabbit IgG One vial containing 125μg of Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, p21. One vial containing 75μL of each primer (5μM) specific for the human p21 (WAF1/CIP1/CDKN1A) promoter. FOR: CCC ACA GCA GAG GAG AAA GAA; REV: CTG GAA ATC TCT GCC CAG ACA
Immunogen	KLH-conjugated linear peptide corresponding to a region between amino acids 1510 and 1540 of the N-CoR protein.
Classification	Polyclonal
Primary or Secondary	Primary

146

MilliporeSigma™ Upstate™ Phospho-CREB (Ser133), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Electromobility Shift Assay,Immunohistochemistry,Immunoprecipitation,Western Blot
Form	Purified
Gene Accession No.	P16220
Isotype	IgG
Includes	This ChIPAb+ Phospho-CREB (Ser133) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Phospho-CREB (Ser133)
Regulatory Status	RUO
Gene Symbols	CREB1, CREB, MGC9284
Purification Method	Purified by protein A-Sepharose followed by immunoadsorbant chromatography using an unphosphorylated CREB affinity gel column
Gene ID (Entrez)	NM_134442
Formulation	Anti-phospho-CREB (Ser133) (rabbit polyclonal). One vial containing 100μg of affinity purified rabbit serum in 0.1M Tris-Glycine (pH 7.4) 0.15M NaCl, and 0.05% sodium azide, before the addition of 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers cFos CRE. One vial containing 75μL of 5μM of each primer specific for the cFos CRE. FOR: GGC CCA CGA GAC CTC TGA GAC A; REV: GCC TTG GCG CGT GTC CTA ATC T
Immunogen	KLH-conjugated synthetic peptide corresponding to the amino acids including and encompassing phosphorylated Ser133 of CREB.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes p43 phosphorylated CREB. May also recognize p30 and p38kDa proteins. The p30 & p38 proteins may be phosphorylated CREM and ATF-1 respectively, since the two proteins share significant homology to the phosphorylated CREB immunizing peptide.

147

Novus Biologicals™ TLR Screening Antibody Pack

For Research applications

Pricing & Availability
Specifications

Antigen	TLR Screening
Content And Storage	Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
Target Species	Human,Mouse
Conjugate	Unconjugated
Applications	Western Blot,Flow Cytometry,Immunohistochemistry,Immunocytochemistry,Immunofluorescence
Immunogen	Following are the different antibodies included in the TLR Sampler Kit: TLR1:25 ug:WB, Flow:H, M, R:Purified TLR2 :25 ug:WB, IHC:H, M:Purified TLR2:25 ug:Flow, IP, ICC:H, D:Purified TLR3:25 ug:WB, Flow, IP, IHC:H:Purified TLR4:25 ug:Flow, IP, CM, FA-Neut:H:Purified TLR5:25 ug:WB, Flow, IHC:H, M, R:Purified TLR7:25 ug:WB, Flow, IHC, IP, IF/ICC:H, M:Purified TLR8:25 ug:WB, Flow, IHC:H, M:Purified TLR9:25 ug:WB, Flow, IHC, IF/ICC, CM:H, M, R, RM:Purified WB:Western Blot IHC:Immunohistochemistry IP:Immunoprecipitation CM:Confocal Microscopy FA-Neut Functional Assay Neutralization IF/ICC:Immunofluorescence/Immunocytochemistry D:Dog H:Human M:Mouse Mk:Monkey R:Rat RM:Rhesus Monkey

148

MilliporeSigma™ RIPAb+™ SMN RIP Validated Antibody and Primer Set

This RIPAb+ SMN -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing & Availability

149

R&D Systems™ Human TIMP Panel Luminex™ Performance Control

Luminex bead-based multiplex assays are designed to provide accurate, reproducible results for every target analyte.

Pricing & Availability

150

MilliporeSigma™ Upstate™ SMRTα, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Electromobility Shift Assay,Immunocytochemistry,Immunohistochemistry,Immunoprecipitation,Western Blot
Form	Ascites
Gene Accession No.	Q9Y618
Isotype	IgG2a κ
Includes	The ChIPAb+ SMRT set includes the SMRT antibody, a negative control mouse ascites and qPCR primers which amplify a 299bp region of human IκBα promoter.
Antigen	SMRTα
Regulatory Status	RUO
Gene Symbols	NCOR2, CTG26, N-CoR2, SMAP270, SMRT, SMRTE, SMRTE-tau, TNRC14, TRAC, TRAC-1, TRAC1
Purification Method	Unpurified
Gene ID (Entrez)	NP_001070729.1
Formulation	Anti-SMRT (mouse monoclonal). One vial containing 50μL of unpurified mouse monoclonal ascites with 0.05% sodium azide. Negative Ascites (mouse). One vial containing 50μL of mouse ascites with 0.05% sodium azide. ChIP Primers, IκBα promoter. One vial containing 75μL of 5μM of each primer specific for human IĸBα promoter. FOR: GAC GAC CCC AAT TCA AAT CG; REV: TCA GGC TCG GGG AAT TTC C
Immunogen	Recombinant protein corresponding to human SMRT.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes SMRT.

Antibody Panels and Kits

Filtered Search Results

Narrow Results

Exosome Detection (Simple Western) Antibody Pack, Novus Biologicals™ Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Novus Biologicals™ Pluripotent Stem Cell Transcription Factor Antibody Pack Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Novus Biologicals™ TLR Screening Antibody Pack Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Exosome Detection (Simple Western) Antibody Pack, Novus Biologicals™

Novus Biologicals™ Pluripotent Stem Cell Transcription Factor Antibody Pack

Novus Biologicals™ TLR Screening Antibody Pack