Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.

Search Within Results

151 – 165 of 1,387 results

151

MilliporeSigma™ RIPAb+™ Fragile X Mental Retardation RIP Validated Antibody and Primer Set

This RIPAb+ Fragile X Mental Retardation Protein -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing & Availability

152

Novus Biologicals™ TLR Screening Antibody Pack

For Research applications

Pricing & Availability
Specifications

Antigen	TLR Screening
Content And Storage	Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
Gene Alias	Toll like receptor, Toll-like receptor, Toll-like receptor (TLR)
Conjugate	Unconjugated
Target Species	Human,Mouse
Applications	Flow Cytometry,Immunocytochemistry,Immunohistochemistry,Immunohistochemistry (Paraffin),Immunoprecipitation,Western Blot
Immunogen	Following are the different antibodies included in the TLR Sampler Kit: TLR1:25 ug:WB, Flow:H, M, R:Purified TLR2 :25 ug:WB, IHC:H, M:Purified TLR2:25 ug:Flow, IP, ICC:H, D:Purified TLR3:25 ug:WB, Flow, IP, IHC:H:Purified TLR4:25 ug:Flow, IP, CM, FA-Neut:H:Purified TLR5:25 ug:WB, Flow, IHC:H, M, R:Purified TLR7:25 ug:WB, Flow, IHC, IP, IF/ICC:H, M:Purified TLR8:25 ug:WB, Flow, IHC:H, M:Purified TLR9:25 ug:WB, Flow, IHC, IF/ICC, CM:H, M, R, RM:Purified WB:Western Blot IHC:Immunohistochemistry IP:Immunoprecipitation CM:Confocal Microscopy FA-Neut Functional Assay Neutralization IF/ICC:Immunofluorescence/Immunocytochemistry D:Dog H:Human M:Mouse Mk:Monkey R:Rat RM:Rhesus Monkey

153

SARS Nucleocapsid Protein Antibody Pack, Novus Biologicals™

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Target Species	SARS-CoV,SARS-CoV-2
Host Species	Rabbit
Conjugate	Unconjugated
Applications	Dual RNAScope ISH-IHC,ELISA,Immunocytochemistry/Immunofluorescence,Immunohistochemistry,Immunohistochemistry (Paraffin),Western Blot
Antigen	SARS Nucleocapsid Protein
Regulatory Status	RUO
Dilution	Western Blot, Immunohistochemistry, Immunocytochemistry/Immunofluorescence, Immunohistochemistry-Paraffin
Gene Alias	2019-nCoV Nucleocapsid Protein, COVID-19 N protein, COVID-19 nucleocapsid protein, N, N protein, N structural protein, NC, Nucleocapsid protein, Nucleoprotein, Protein N, SARS coronavirus N protein, SARS coronavirus nucleocapsid protein, SARS CoV, SARS CoV N protein, SARS CoV nucleocapsid protein, SARS N protein, SARS Nucleoprotein, SARSCoV, SARSCoV N protein, SARSCoV nucleocapsid protein, SARS-CoV-2 N protein, SARSCOV2 N protein, SARS-COV-2 nucleocapsid protein, SARS-COV-2 Nucleoprotein, Severe acute respiratory syndrome
Gene ID (Entrez)	1489678
Formulation	NB100-56576 and NB100-56683: PBS, 0.05% Sodium Azide. NBP2-44205: 0.02 M Potassium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 0.01% Sodium Azide.
Classification	Polyclonal
Immunogen	See individual datasheets.
Primary or Secondary	Primary

154

BD Mouse Th17/Treg Phenotyping Kit

Simultaneously view TH17 and regulatory T cells in mouse model systems

Pricing & Availability

155

Avian Influenza A H4N6 Hemagglutinin Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™

Antibody pair for Solid phase sandwich ELISA

Pricing & Availability
Specifications

Antigen	Avian Influenza A H4N6 Hemagglutinin
Regulatory Status	RUO
Content And Storage	Storage of components varies. See protocol for specific instructions.
Gene Alias	Harvey rat sarcoma viral oncogene homolog
Target Species	Virus
Host Species	Mouse
Conjugate	HRP
Applications	ELISA,Sandwich ELISA
Product Type	Antibody Pairs
Classification	Monoclonal

156

MilliporeSigma™ Upstate™ TCF-4α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Dot Blot,Western Blot
Form	Purified
Gene Accession No.	Q9NQB0
Isotype	IgG2a
Includes	This ChIPAb+ TCF-4 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	TCF-4α
Regulatory Status	RUO
Gene Symbols	TCF4, TCF-4, TCF7L2
Purification Method	Protein G chromatography
Gene ID (Entrez)	CAB97213.1
Formulation	Anti-TCF-4 (mouse monoclonal). One vial containing 50μg of purified mouse monoclonal IgG2a in 50μL of buffer containing 0.1 M Tris-glycine, pH 7.4, 0.15 M NaCl, 0.05% sodium azide and 30% glycerol. Normal Mouse IgG. Two vials containing 25μg of purified IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, SP5 promote. One vial containing 75μL of 5μM of each primer specific for human SP5 promotor. FOR: GGG TCT CCA GGC GGC AAG; REV: AGC GAA AGC AAA TCC TTT GAA TCC
Immunogen	Amino acids 31-331 of human TCF-4.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes TCF-4

157

BD Biotin Mouse CD8 T Lymphocyte Enrichment Set - DM

Negative selection of CD8 T lymphocytes from mouse spleen or lymph node

Pricing & Availability

158

BD Biotin Mouse Hematopoietic Progenitor (Stem) Enrichment Set - DM

For immunomagnetic enrichment of hematopoietic progenitors

Pricing & Availability

159

BD Biotin Mouse Dendritic Cell Enrichment Set - DM

For the negative selection of dendritic cells (DC) from mouse spleen or lymph node

Pricing & Availability

160

MilliporeSigma™ Upstate™ Acetyl-Histone H3 (Lys9/18), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Serum
Gene Accession No.	Q16695
Includes	This ChIPAb+ Acetyl-Histone H3 (Lys9/18) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Acetyl-Histone H3 (Lys9/18)
Regulatory Status	RUO
Gene Symbols	H3F3A, MGC87783, H3.3A, MGC87782, H3F3, H3.3B, H3F3B
Purification Method	Unpurified
Gene ID (Entrez)	NM_003493
Formulation	Anti-Acetyl-Histone H3 (Lys9/18) (rabbit polyclonal). One vial containing 25μL of rabbit antiserum containing 0.05% sodium azide before the addition of glycerol to 30%. Normal Rabbit Serum. One vial containing 25μL of antiserum containing 0.05% sodium azide. Control Primers, human GAPDH promoter. One vial containing 75μL of 5μM of each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	KLH-conjugated synthetic peptide (..ARAcKSTGGKAPRAcKQL..) in which AcK corresponds to acetyl-lysine at residue 9 and 18 of human Histone H3.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Histone H3 acetylated on lysines 9 and 18.

161

MilliporeSigma™ Upstate™ HDAC2α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	Q92769
Isotype	IgG1
Includes	This ChIPAb+ HDAC2 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	HDAC2α
Regulatory Status	RUO
Gene Symbols	HDAC2, HD2, YAF1, RPD3
Purification Method	Protein G purified
Gene ID (Entrez)	NP_001518
Formulation	Anti-HDAC2 (mouse monoclonal). One vial containing 50μg of purified mouse monoclonal IgG in buffer containing 70% storage buffer (0.1M Tris-glycine, pH 7.4, 0.15M NaCl, 0.05% sodium azide) and 30% glycerol. Concentration: 0.94mg/mL. Normal Mouse IgG. One vial containing 125μg of purified mouse IgG in 125μL of storage buffer containing 0.1% sodium azide. ChIP Primers, VWF promoter. One vial containing 75μL of 5μM of each primer specific for the promoter region of human von Willebrand factor. FOR: GCT GAG AGC ATG GCC TAG GGT GGT GGG CGG CAC; REV: CCC CTG CAA ATG AGG GCT GCG GCT ATC TCC AAG
Immunogen	KLH-conjugated,synthetic peptide (CEKTDTKGTKSEQLSNP) corresponding to human HDAC2 at the C-terminus.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes HDAC2 at the C-terminus.

162

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form	Purified
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Trimethyl-Histone H3 (Lys36)α
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.

163

MilliporeSigma™ P2X7 Receptor (576-595), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Includes	50μL antibody lyophilized from PBS, 1% BSA, pH 7.4 and 40μg lyophilized control peptide (immunogen).
Antigen	P2X7 Receptor (576-595)
Regulatory Status	RUO
Content And Storage	−20°C
Host Species	Rabbit
Applications	Immunoblot,Immunoblot
Form	Purified
Formulation	50μl antibody lyophilized from PBS, 1% BSA, pH 7.4 and 40μg lyophilized control peptide (immunogen).
Immunogen	a synthetic peptide [(C)KIRKEFPKTQGQYSGFKYPY] corresponding to amino acids 576-595 of rat P2X7 receptor,conjugated to receptor protein
Classification	Polyclonal
Isotype	IgG
Primary or Secondary	Primary
Test Specificity	Recognizes the P2X7 receptor protein. Supplied with a control peptide.

164

MilliporeSigma™ Upstate™ Acetyl-Histone H4 (Lys16), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Immunoprecipitation,Western Blot
Form	Purified
Gene Accession No.	P62805
Includes	This ChIPAb+ Acetyl-Histone H4 (Lys16) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Acetyl-Histone H4 (Lys16)
Regulatory Status	RUO
Gene Symbols	HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_778224.1
Formulation	Anti-Acetyl-Histone H4 (Lys16) (rabbit polyclonal). One vial containing 50μL of affinity purified rabbit polyclonal serum in buffer containing 0.1 M Tris-Glycine (pH 7.4) 150mM NaCl with 0.05% sodium azide. Normal Rabbit IgG. One vial containing 125μg of rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, RPL10 promoter. One vial containing 75μL of 5μM of each primer specific for the promoter region of human RPL10. FOR: ACC CGT CTT CGA CAG GAC T; REV: GGA ACG GAA GAC GAG AAC AG
Immunogen	KLH-conjugated Histone H4 corresponding to the N-terminus region at and around acetylated Lys16.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	This antibody detects histone H4 acetylated at Lys16.

165

MilliporeSigma™ Upstate™ Acetyl-Histone H3 (Lys4), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Gene Accession No.	Q16695
Includes	This ChIPAb+ Acetyl-Histone H3 (Lys4) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Acetyl-Histone H3 (Lys4)
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g , H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Acetyl-Histone H3 (Lys4) (rabbit polyclonal). One vial containing 100μL of immunoaffinity purified rabbit polyclonal in storage buffer containing 0.05% sodium azide with 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	KLH-conjugated,synthetic peptide containing the sequence …RTAcKQ… in which AcK corresponds to acetyl lysine 4 of human histone H3.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Histone H3 acetylated on Lys4.

Antibody Panels and Kits

Filtered Search Results

Narrow Results

Novus Biologicals™ TLR Screening Antibody Pack Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

SARS Nucleocapsid Protein Antibody Pack, Novus Biologicals™ Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Avian Influenza A H4N6 Hemagglutinin Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™ Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Novus Biologicals™ TLR Screening Antibody Pack

SARS Nucleocapsid Protein Antibody Pack, Novus Biologicals™

Avian Influenza A H4N6 Hemagglutinin Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™