Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.

Search Within Results

196 – 210 of 1,323 results

196

MilliporeSigma™ Upstate™ Acetyl-Histone H3 (Lys4), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Gene Accession No.	Q16695
Includes	This ChIPAb+ Acetyl-Histone H3 (Lys4) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Acetyl-Histone H3 (Lys4)
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g , H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Acetyl-Histone H3 (Lys4) (rabbit polyclonal). One vial containing 100μL of immunoaffinity purified rabbit polyclonal in storage buffer containing 0.05% sodium azide with 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	KLH-conjugated,synthetic peptide containing the sequence …RTAcKQ… in which AcK corresponds to acetyl lysine 4 of human histone H3.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Histone H3 acetylated on Lys4.

197

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form	Purified
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Trimethyl-Histone H3 (Lys36)α
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.

198

MilliporeSigma™ Upstate™ ChIPAb+™ Dimethyl-Histone H3 (Lys79)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Culture Supernatant
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Dimethyl-Histone H3 (Lys79) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	ChIPAb+™ Dimethyl-Histone H3 (Lys79)α
Regulatory Status	RUO
Gene Symbols	H3F3A, H3F3B
Gene ID (Entrez)	NM_003493
Formulation	Anti-Dimethyl-Histone H3 (Lys79) (rabbit Monoclonal), One vial containing 100μL of cultured supernatant in 0.05% sodium azide. Negative Control Supernatant, One vial containing 100μL of cultured supernatant in 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM of each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	KLH-conjugated synthetic peptide containing the sequence DF_me2KTD corresponding to dimethyl-lysine at position 79 of histone H3. The immunizing sequence is identical in human,mouse,rat and yeast. A C-terminal cysteine was added to facilitate conjugation.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes dimethyl-histone H3 (Lys79).

199

MilliporeSigma™ Upstate™ RNA Pol IIα, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C for one year from date of shipment
Host Species	Mouse
Applications	ChIP Assay,Immunofluorescence,Immunoprecipitation
Form	Purified
Gene Accession No.	P24928
Isotype	IgG1
Includes	RNA Pol II ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of RNA Pol II.
Antigen	RNA Pol IIα
Regulatory Status	RUO
Purification Method	Protein G purified
Gene ID (Entrez)	NP_000928
Formulation	Anti-RNA Pol II (mouse monoclonal IgG1,purified). One vial containing 25μg of purified antibody in 25μL volume. Normal Mouse IgG. One vial containing 25μg of mouse IgG in 25μL volume. Control Primers p21. One vial containing 75μL of 5μM of each primer specific for a region of the human GAPDH promoter. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	The RNA Pol II antibody is made against a peptide corresponding to the C-terminal domain of RNA Pol II.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes RNA Pol II

200

MilliporeSigma™ Upstate™ TCF-4α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Dot Blot,Western Blot
Form	Purified
Gene Accession No.	Q9NQB0
Isotype	IgG2a
Includes	This ChIPAb+ TCF-4 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	TCF-4α
Regulatory Status	RUO
Gene Symbols	TCF4, TCF-4, TCF7L2
Purification Method	Protein G chromatography
Gene ID (Entrez)	CAB97213.1
Formulation	Anti-TCF-4 (mouse monoclonal). One vial containing 50μg of purified mouse monoclonal IgG2a in 50μL of buffer containing 0.1 M Tris-glycine, pH 7.4, 0.15 M NaCl, 0.05% sodium azide and 30% glycerol. Normal Mouse IgG. Two vials containing 25μg of purified IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, SP5 promote. One vial containing 75μL of 5μM of each primer specific for human SP5 promotor. FOR: GGG TCT CCA GGC GGC AAG; REV: AGC GAA AGC AAA TCC TTT GAA TCC
Immunogen	Amino acids 31-331 of human TCF-4.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes TCF-4

201

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys9), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C in undiluted aliquots for up to 12 months from date of receipt; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Western Blot
Form	Purified
Gene Accession No.	Q16695
Includes	Trimethyl-Histone H3 (Lys9) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K9Me3.
Antigen	Trimethyl-Histone H3 (Lys9)
Regulatory Status	RUO
Gene Symbols	H3F3A, MGC87783, H3.3A, MGC87782, H3F3, H3.3B, H3F3B
Gene ID (Entrez)	NP_003484
Formulation	Anti-trimethyl-Histone H3 (Lys9) (rabbit polyclonal IgG). One vial containing 100μg protein A purified IgG in 100μL of 0.02 M Phosphate buffer, pH 7.4, 0.25 M NaCl, 0.05% sodium azide with 30% glycerol. Normal Rabbit IgG. One vial containing 125μg of normal rabbit IgG in 125μL storage buffer containing 0.1% sodium azide. ChIP Primers, ZNF554. One vial containing 75μL of 5μM of each primer specific for ZNF554. FOR: CGG GGA AAA GCC CTA TAA AT; REV: TCC ACA TTC ACT GCA TTC GT
Immunogen	The trimethyl-histone H3 (Lys9) purified antibody is made against BSA-conjugated,synthetic peptide containing the sequence …AR[me3K]S… in which me3K corresponds to trimethyl lysine 9 of human Histone H3.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes histone H3, Mr 17kDa, trimethylated at lysine 9.

202

MilliporeSigma™ Upstate™ CHD1, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	O14646
Includes	This ChIPAb+ Validated Antibody and Primer Set conveniently includes the antibody, matched IgG negative control antibody and set control PCR primers that detect a known positive locus.
Antigen	CHD1
Regulatory Status	RUO
Gene Symbols	Chd1, Chd-1
Gene ID (Entrez)	NP_001261
Formulation	Anti-CHD1 (Rabbit Polyclonal). One vial containing 7.0μg purified rabbit polyclonal in 50μL buffer of Tris-buffered Saline containing 0.1% BSA and 0.09% Sodium Azide, before the addition of 30% glycerol (0.14mg/mL final). Normal Rabbit IgG. One vial containing 125μg of purified Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers, PSMC6. One vial containing 75μL of 5μM of each primer specific for human proteasome 26S subunit 6 (chr14:53174161+53174274 , hg19 build). Primer location selection based on ENCODE browser data at UCSC, see also reference 1. FOR: TCC GGC CCT GAG CTT GT; REV: CCT CCT CTA CTT CTT TTT CAT TTT CAC
Immunogen	Recombinant protein corresponding to human CHD1 (a.a. 1660-1710).
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes CHD1 in regions between a.a. 1660 to 1710.

203

MilliporeSigma™ Upstate™ Acetyl-Histone H3, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C from date of receipt
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	P68431
Includes	Acetyl-Histone H3 ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3Ac.
Antigen	Acetyl-Histone H3
Regulatory Status	RUO
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Acetyl-Histone H3 (rabbit polyclonal IgG). One vial containing 125μg of protein A purified antibody in 125μL of storage buffer containing 0.1M Tris-glycine, pH 7.4, 0.15M NaCl, 0.05% sodium azide. Normal Rabbit IgG. One vial containing 125μg of normal rabbit IgG in 125μL volume. Control Primers. One vial containing 75μL of 5μM of each primer specific for for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	The acetyl-histone H3 antibody is made against a peptide corresponding to amino acids 1-20 of Tetrahymena histone H3 ARTKQTAR[K]STGG[K]APRKQL(C) where [K] is acetylated)
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes acetyl-histone H3

204

Avian Influenza A H4N6 Hemagglutinin Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™

Antibody pair for Solid phase sandwich ELISA

Pricing & Availability

205

Promotions Available

BD Mouse TCR V β Screening Panel

Monoclonal antibodies for T-cell receptors recognition

Pricing & Availability

206

MilliporeSigma™ RIPAb+™ IGF2 mRNA-Binding Protein 3 RIP Validated Antibody and Primer Set

This RIPAb+ IGF2 mRNA-binding protein 3 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing & Availability

207

MilliporeSigma™ Upstate™ Acetyl-Histone H3 (Lys9) Serum, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C from date of receipt
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Serum
Gene Accession No.	Q66I33
Includes	This ChIPAb+ Acetyl-Histone H3 (Lys9) Serum -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Acetyl-Histone H3 (Lys9) Serum
Regulatory Status	RUO
Gene Symbols	H3F3A, H3F3B, H3F3
Gene ID (Entrez)	NM_003493
Formulation	Anti-Acetyl-Histone H3 (Lys9) (rabbit polyclonal serum). One vial containing 25μL of antiserum containing 0.05% sodium azide before the addition of glycerol to 30%. Normal Rabbit Serum. One vial containing 25μL antiserum containing 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM of each primer specific for for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	The acetyl-histone H3 (Lys9) antiserum is made against a peptide corresponding to amino acids 4-14 of yeast histone H3 acetylated on lysine 9.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Acetyl-Histone H3 (Lys9)

208

MilliporeSigma™ Upstate™ SMRTα, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Electromobility Shift Assay,Immunocytochemistry,Immunohistochemistry,Immunoprecipitation,Western Blot
Form	Ascites
Gene Accession No.	Q9Y618
Isotype	IgG2a κ
Includes	The ChIPAb+ SMRT set includes the SMRT antibody, a negative control mouse ascites and qPCR primers which amplify a 299bp region of human IκBα promoter.
Antigen	SMRTα
Regulatory Status	RUO
Gene Symbols	NCOR2, CTG26, N-CoR2, SMAP270, SMRT, SMRTE, SMRTE-tau, TNRC14, TRAC, TRAC-1, TRAC1
Purification Method	Unpurified
Gene ID (Entrez)	NP_001070729.1
Formulation	Anti-SMRT (mouse monoclonal). One vial containing 50μL of unpurified mouse monoclonal ascites with 0.05% sodium azide. Negative Ascites (mouse). One vial containing 50μL of mouse ascites with 0.05% sodium azide. ChIP Primers, IκBα promoter. One vial containing 75μL of 5μM of each primer specific for human IĸBα promoter. FOR: GAC GAC CCC AAT TCA AAT CG; REV: TCA GGC TCG GGG AAT TTC C
Immunogen	Recombinant protein corresponding to human SMRT.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes SMRT.

209

Novus Biologicals™ ARNT/HIF-1 beta Antibody Pack

For Research applications

Pricing & Availability

210

MilliporeSigma™ Upstate™ REST, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	Q13127
Includes	This ChIPAb+ REST -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	REST
Regulatory Status	RUO
Gene Symbols	NRSF, XBR
Gene ID (Entrez)	NP_005603
Formulation	Anti-REST (Rabbit Polyclonal). One vial containing 100μL 1.0mg/mL purified rabbit polyclonal in buffer containing 0.014M phosphate buffer, pH 7.6, 0.175M NaCl, 0.07% sodium azide, and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers, human Snap25. One vial containing 75μL of 5μM of each primer specific for human Snap25 promoter. FOR: AGA CTC CTT TGC AGA CAA TTT CCT; REV: CAA CAC AGA AGA TTT CCA CAA GTA GAC
Immunogen	The REST purified antibody is made against a GST fusion protein corresponding to amino acids 801-1097 of human REST.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes REST, MW 125kDa predicted, 200kDa observed.

Antibody Panels and Kits

Filtered Search Results

Narrow Results

MilliporeSigma™ Upstate™ RNA Pol IIα, Mouse monoclonal, ChIP Validated Antibody and Primer Set GSA/VA ContractAvailable on GSA/VA contract for Federal Government customers.Learn More

Avian Influenza A H4N6 Hemagglutinin Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™ Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Novus Biologicals™ ARNT/HIF-1 beta Antibody Pack Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

MilliporeSigma™ Upstate™ RNA Pol IIα, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Avian Influenza A H4N6 Hemagglutinin Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™

Novus Biologicals™ ARNT/HIF-1 beta Antibody Pack